The Space Life Sciences Ontology is an application ontology and is intended to support the operation of NASA's Life Sciences Data Archive and other systems that contain space life science research data. Space Life Sciences Ontology 2024-03-26 Relates an entity in the ontology to the name of the variable that is used to represent it in the code that generates the BFO OWL file from the lispy specification. Really of interest to developers only BFO OWL specification label Used to annotation axioms that define identity criteria for instances of a class. is_identity_criteria editor preferred label editor preferred label editor preferred term editor preferred term editor preferred term~editor preferred label The concise, meaningful, and human-friendly name for a class or property preferred by the ontology developers. (US-English) PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> editor preferred label editor preferred label editor preferred term editor preferred term editor preferred term~editor preferred label example of usage A phrase describing how a class name should be used. May also include other kinds of examples that facilitate immediate understanding of a class semantics, such as widely known prototypical subclasses or instances of the class. Although essential for high level terms, examples for low level terms (e.g., Affymetrix HU133 array) are not. A phrase describing how a term should be used and/or a citation to a work which uses it. May also include other kinds of examples that facilitate immediate understanding, such as widely know prototypes or instances of a class, or cases where a relation is said to hold. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> IAO example of usage example of usage definition definition textual definition The official OBI definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions. The official definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions. 2012-04-05: Barry Smith The official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible. Can you fix to something like: A statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property. Alan Ruttenberg Your proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. On the specifics of the proposed definition: We don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. Personally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. We also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with. 2012-04-05: Barry Smith The official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible. Can you fix to something like: A statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property. Alan Ruttenberg Your proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. On the specifics of the proposed definition: We don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. Personally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. We also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> definition definition textual definition editor note An administrative note intended for its editor. It may not be included in the publication version of the ontology, so it should contain nothing necessary for end users to understand the ontology. PERSON:Daniel Schober GROUP:OBI:<http://purl.obofoundry.org/obo/obi> editor note term editor Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people 20110707, MC: label update to term editor and definition modified accordingly. See https://github.com/information-artifact-ontology/IAO/issues/115. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> term editor alternative label alternative term A label for a class or property that can be used to refer to the class or property instead of the preferred rdfs:label. Alternative labels should be used to indicate community- or context-specific labels, abbreviations, shorthand forms and the like. An alternative name for a class or property which means the same thing as the preferred name (semantically equivalent) OBO Operations committee PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> Consider re-defing to: An alternative name for a class or property which can mean the same thing as the preferred name (semantically equivalent, narrow, broad or related). alternative label alternative term alternative term definition source Formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007 PERSON:Daniel Schober Discussion on obo-discuss mailing-list, see http://bit.ly/hgm99w GROUP:OBI:<http://purl.obolibrary.org/obo/obi> definition source definition source If R <- P o Q is a defining property chain axiom, then it also holds that R -> P o Q. Note that this cannot be expressed directly in OWL is a defining property chain axiom If R <- P o Q is a defining property chain axiom, then (1) R -> P o Q holds and (2) Q is either reflexive or locally reflexive. A corollary of this is that P SubPropertyOf R. is a defining property chain axiom where second argument is reflexive Defines the label for the property as shown in NASA Life Sciences Portal Label in NLSP Defines the label for the property in ARC SLIMS database SLIMS Label Defines the label for the property in ARC SLIMS database Object property Defines the field label propery in NASA Life Sciences Portal NLSP field name Examples of a Contributor include a person, an organisation, or a service. Typically, the name of a Contributor should be used to indicate the entity. 1999-07-02 2002-10-04 An entity responsible for making contributions to the content of the resource. Contributor Coverage will typically include spatial location (a place name or geographic coordinates), temporal period (a period label, date, or date range) or jurisdiction (such as a named administrative entity). Recommended best practice is to select a value from a controlled vocabulary (for example, the Thesaurus of Geographic Names [TGN]) and that, where appropriate, named places or time periods be used in preference to numeric identifiers such as sets of coordinates or date ranges. 1999-07-02 2002-10-04 The extent or scope of the content of the resource. Coverage Examples of a Creator include a person, an organisation, or a service. Typically, the name of a Creator should be used to indicate the entity. 1999-07-02 2002-10-04 An entity primarily responsible for making the content of the resource. Creator Typically, Date will be associated with the creation or availability of the resource. Recommended best practice for encoding the date value is defined in a profile of ISO 8601 [W3CDTF] and follows the YYYY-MM-DD format. 1999-07-02 2002-10-04 A date associated with an event in the life cycle of the resource. Date Date Description may include but is not limited to: an abstract, table of contents, reference to a graphical representation of content or a free-text account of the content. 1999-07-02 2002-10-04 An account of the content of the resource. Description Description Typically, Format may include the media-type or dimensions of the resource. Format may be used to determine the software, hardware or other equipment needed to display or operate the resource. Examples of dimensions include size and duration. Recommended best practice is to select a value from a controlled vocabulary (for example, the list of Internet Media Types [MIME] defining computer media formats). 1999-07-02 2002-10-04 The physical or digital manifestation of the resource. Format Recommended best practice is to identify the resource by means of a string or number conforming to a formal identification system. Example formal identification systems include the Uniform Resource Identifier (URI) (including the Uniform Resource Locator (URL)), the Digital Object Identifier (DOI) and the International Standard Book Number (ISBN). 1999-07-02 2002-10-04 An unambiguous reference to the resource within a given context. Resource Identifier Recommended best practice is to use RFC 3066 [RFC3066], which, in conjunction with ISO 639 [ISO639], defines two- and three-letter primary language tags with optional subtags. Examples include "en" or "eng" for English, "akk" for Akkadian, and "en-GB" for English used in the United Kingdom. 1999-07-02 2002-10-04 A language of the intellectual content of the resource. Language Examples of a Publisher include a person, an organisation, or a service. Typically, the name of a Publisher should be used to indicate the entity. 1999-07-02 2002-10-04 An entity responsible for making the resource available Publisher Recommended best practice is to reference the resource by means of a string or number conforming to a formal identification system. 1999-07-02 2002-10-04 A reference to a related resource. Relation Typically, a Rights element will contain a rights management statement for the resource, or reference a service providing such information. Rights information often encompasses Intellectual Property Rights (IPR), Copyright, and various Property Rights. If the Rights element is absent, no assumptions can be made about the status of these and other rights with respect to the resource. 1999-07-02 2002-10-04 Information about rights held in and over the resource. Rights Management The present resource may be derived from the Source resource in whole or in part. Recommended best practice is to reference the resource by means of a string or number conforming to a formal identification system. 1999-07-02 2002-10-04 A reference to a resource from which the present resource is derived. Source Typically, a Subject will be expressed as keywords, key phrases or classification codes that describe a topic of the resource. Recommended best practice is to select a value from a controlled vocabulary or formal classification scheme. 1999-07-02 2002-10-04 The topic of the content of the resource. Subject and Keywords Typically, a Title will be a name by which the resource is formally known. Typically, a Title will be a name by which the resource is formally known. 1999-07-02 2002-10-04 A name given to the resource. Title Title Type includes terms describing general categories, functions, genres, or aggregation levels for content. Recommended best practice is to select a value from a controlled vocabulary (for example, the DCMI Type Vocabulary [DCMITYPE]). To describe the physical or digital manifestation of the resource, use the Format element. 1999-07-02 2002-10-04 The nature or genre of the content of the resource. Resource Type 2000-07-11 2002-06-15 A summary of the content of the resource. Abstract Access Rights may include information regarding access or restrictions based on privacy, security or other regulations. 2003-02-15 Information about who can access the resource or an indication of its security status. Access Rights This qualifier can include Title abbreviations as well as translations. 2000-07-11 2002-06-15 Any form of the title used as a substitute or alternative to the formal title of the resource. Alternative A class of entity may be determined by the creator or the publisher or by a third party. 2001-05-21 2002-06-15 A class of entity for whom the resource is intended or useful. Audience 2000-07-11 2002-06-15 Date (often a range) that the resource will become or did become available. Available Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible, whether or not the citation is in a standard form. 2003-02-15 A bibliographic reference for the resource. Bibliographic Citation 2001-05-21 2002-06-15 A reference to an established standard to which the resource conforms. Conforms To 2000-07-11 2002-06-15 Date of creation of the resource. Created 2002-07-13 Date of acceptance of the resource (e.g. of thesis by university department, of article by journal, etc.). Date Accepted 2002-07-13 Date of a statement of copyright. Date Copyrighted 2002-07-13 Date of submission of the resource (e.g. thesis, articles, etc.). Date Submitted description 2002-07-13 A general statement describing the education or training context. Alternatively, a more specific statement of the location of the audience in terms of its progression through an education or training context. Audience Education Level 2000-07-11 2002-06-15 The size or duration of the resource. Extent 2000-07-11 2002-06-15 The described resource pre-existed the referenced resource, which is essentially the same intellectual content presented in another format. Has Format 2000-07-11 2002-06-15 The described resource includes the referenced resource either physically or logically. Has Part 2000-07-11 2002-06-15 The described resource has a version, edition, or adaptation, namely, the referenced resource. Has Version 2000-07-11 2002-06-15 The described resource is the same intellectual content of the referenced resource, but presented in another format. Is Format Of 2000-07-11 2002-06-15 The described resource is a physical or logical part of the referenced resource. Is Part Of 2000-07-11 2002-06-15 The described resource is referenced, cited, or otherwise pointed to by the referenced resource. Is Referenced By 2000-07-11 2002-06-15 The described resource is supplanted, displaced, or superseded by the referenced resource. Is Replaced By 2000-07-11 2002-06-15 The described resource is required by the referenced resource, either physically or logically. Is Required By 2000-07-11 2002-06-15 The described resource is a version, edition, or adaptation of the referenced resource. Changes in version imply substantive changes in content rather than differences in format. Is Version Of 2000-07-11 2002-06-15 Date of formal issuance (e.g., publication) of the resource. Issued Mark Miller 2018-05-11T13:47:29Z license The audiences for a resource are of two basic classes: (1) an ultimate beneficiary of the resource, and (2) frequently, an entity that mediates access to the resource. The mediator element refinement represents the second of these two classes. 2001-05-21 2002-07-13 A class of entity that mediates access to the resource and for whom the resource is intended or useful. Mediator 2000-07-11 2002-06-15 The material or physical carrier of the resource. Medium 2000-07-11 2002-06-15 Date on which the resource was changed. Modified 2000-07-11 2002-06-15 The described resource references, cites, or otherwise points to the referenced resource. References 2000-07-11 2002-06-15 The described resource supplants, displaces, or supersedes the referenced resource. Replaces 2000-07-11 2002-06-15 The described resource requires the referenced resource to support its function, delivery, or coherence of content. Requires 2000-07-11 2002-06-15 Spatial characteristics of the intellectual content of the resoure. Spatial 2000-07-11 2002-06-15 A list of subunits of the content of the resource. Table Of Contents 2000-07-11 2002-06-15 Temporal characteristics of the intellectual content of the resource. Temporal title 2000-07-11 2002-06-15 Date (often a range) of validity of a resource. Valid has_related_synonym label label This axiom needed so that Protege loads DCAT2 without errors. is part of my brain is part of my body (continuant parthood, two material entities) my stomach cavity is part of my stomach (continuant parthood, immaterial entity is part of material entity) this day is part of this year (occurrent parthood) For continuants: C part_of C' if and only if: given any c that instantiates C at a time t, there is some c' such that c' instantiates C' at time t, and c *part_of* c' at t. For processes: P part_of P' if and only if: given any p that instantiates P at a time t, there is some p' such that p' instantiates P' at time t, and p *part_of* p' at t. (Here *part_of* is the instance-level part-relation.) a core relation that holds between a part and its whole Everything is part of itself. Any part of any part of a thing is itself part of that thing. Two distinct things cannot be part of each other. Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See http://purl.obolibrary.org/obo/ro/docs/temporal-semantics/ Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See https://code.google.com/p/obo-relations/wiki/ROAndTime Parthood requires the part and the whole to have compatible classes: only an occurrent can be part of an occurrent; only a process can be part of a process; only a continuant can be part of a continuant; only an independent continuant can be part of an independent continuant; only an immaterial entity can be part of an immaterial entity; only a specifically dependent continuant can be part of a specifically dependent continuant; only a generically dependent continuant can be part of a generically dependent continuant. (This list is not exhaustive.) A continuant cannot be part of an occurrent: use 'participates in'. An occurrent cannot be part of a continuant: use 'has participant'. A material entity cannot be part of an immaterial entity: use 'has location'. A specifically dependent continuant cannot be part of an independent continuant: use 'inheres in'. An independent continuant cannot be part of a specifically dependent continuant: use 'bearer of'. part_of BFO:0000050 source part_of part_of is part of part of part of http://www.obofoundry.org/ro/#OBO_REL:part_of https://wiki.geneontology.org/Part_of For continuants: C part_of C' if and only if: given any c that instantiates C at a time t, there is some c' such that c' instantiates C' at time t, and c *part_of* c' at t. For processes: P part_of P' if and only if: given any p that instantiates P at a time t, there is some p' such that p' instantiates P' at time t, and p *part_of* p' at t. (Here *part_of* is the instance-level part-relation.) PMID:15892874 has part my body has part my brain (continuant parthood, two material entities) my stomach has part my stomach cavity (continuant parthood, material entity has part immaterial entity) this year has part this day (occurrent parthood) a core relation that holds between a whole and its part Everything has itself as a part. Any part of any part of a thing is itself part of that thing. Two distinct things cannot have each other as a part. Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See http://purl.obolibrary.org/obo/ro/docs/temporal-semantics/ Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See https://code.google.com/p/obo-relations/wiki/ROAndTime Parthood requires the part and the whole to have compatible classes: only an occurrent have an occurrent as part; only a process can have a process as part; only a continuant can have a continuant as part; only an independent continuant can have an independent continuant as part; only a specifically dependent continuant can have a specifically dependent continuant as part; only a generically dependent continuant can have a generically dependent continuant as part. (This list is not exhaustive.) A continuant cannot have an occurrent as part: use 'participates in'. An occurrent cannot have a continuant as part: use 'has participant'. An immaterial entity cannot have a material entity as part: use 'location of'. An independent continuant cannot have a specifically dependent continuant as part: use 'bearer of'. A specifically dependent continuant cannot have an independent continuant as part: use 'inheres in'. has_part BFO:0000051 source has_part has_part has part has part has_part realized in this disease is realized in this disease course this fragility is realized in this shattering this investigator role is realized in this investigation is realized by realized_in [copied from inverse property 'realizes'] to say that b realizes c at t is to assert that there is some material entity d & b is a process which has participant d at t & c is a disposition or role of which d is bearer_of at t& the type instantiated by b is correlated with the type instantiated by c. (axiom label in BFO2 Reference: [059-003]) Paraphrase of elucidation: a relation between a realizable entity and a process, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process realized in realizes this disease course realizes this disease this investigation realizes this investigator role this shattering realizes this fragility to say that b realizes c at t is to assert that there is some material entity d & b is a process which has participant d at t & c is a disposition or role of which d is bearer_of at t& the type instantiated by b is correlated with the type instantiated by c. (axiom label in BFO2 Reference: [059-003]) Paraphrase of elucidation: a relation between a process and a realizable entity, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process realizes preceded by x is preceded by y if and only if the time point at which y ends is before or equivalent to the time point at which x starts. Formally: x preceded by y iff ω(y) <= α(x), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point. An example is: translation preceded_by transcription; aging preceded_by development (not however death preceded_by aging). Where derives_from links classes of continuants, preceded_by links classes of processes. Clearly, however, these two relations are not independent of each other. Thus if cells of type C1 derive_from cells of type C, then any cell division involving an instance of C1 in a given lineage is preceded_by cellular processes involving an instance of C. The assertion P preceded_by P1 tells us something about Ps in general: that is, it tells us something about what happened earlier, given what we know about what happened later. Thus it does not provide information pointing in the opposite direction, concerning instances of P1 in general; that is, that each is such as to be succeeded by some instance of P. Note that an assertion to the effect that P preceded_by P1 is rather weak; it tells us little about the relations between the underlying instances in virtue of which the preceded_by relation obtains. Typically we will be interested in stronger relations, for example in the relation immediately_preceded_by, or in relations which combine preceded_by with a condition to the effect that the corresponding instances of P and P1 share participants, or that their participants are connected by relations of derivation, or (as a first step along the road to a treatment of causality) that the one process in some way affects (for example, initiates or regulates) the other. is preceded by preceded_by http://www.obofoundry.org/ro/#OBO_REL:preceded_by http://www.obofoundry.org/ro/#OBO_REL:preceded_by preceded by precedes x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point. precedes is_genotype_of A relationship that holds between a biological entity and some level of genetic variation present in its genome. This relation aims to be equally as broad/inclusive as RO:0002200 ! has_phenotype. The biological entity can be an organism, a group of organism that share common genotype, or organism-derived entities such as cell lines or biospecimens. The genotype can be any of the various flavors of genotypes/allelotypes defined in GENO (intrinsic genotype, extrinsic genotype, effective genotype), or any genetic variation component of a genotype including variant alleles or sequence alterations. has_genotype A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears. has_sequence_component has_state VMC:state 'Sequence' in the context of GENO is an abstract entity representing an ordered collection of monomeric units as carried in a biological macromolecule. has_sequence is_sequence_of is_subject_of A relation used to describe a context or conditions that define and/or identify an entity. Used in Monarch Data to link associations to qualifying contexts (e.g. environments or developmental stages) where the association applies. For example, a qualifying environment represents a context where genotype-phenotype associations apply - where the environment is an identity criteria for the association. Used in GENO to describe physical context of materialized sequence features that represent identifying criteria for instances of qualified sequence features. has_qualifying_context has_qualifier A relation linking a qualified sequence feature to its component sequence feature. has_sequence_feature_component In GENO we define three levels of sequence artifacts: (1) biological sequences, (2) sequence features, and (3) qualified sequence features. The identify criteria for a 'biological sequence' include only its inherent sequence (the ordered string of units that comprise it). The identity criteria for a 'sequence feature' include its sequence and position (where it resides - i.e. its location based on how it maps to a reference or standard) The identity criteria for a 'qualified sequence feature' include its component sequence feature (defined by its sequence and position), and the material context of its bearer in a cell or organism. This context can include direct epigenetic modification, or being targeted by gene knockdown reagents such as morpholinos or RNAi, or being transiently overexpressed from a transgenic construct in a cell or organism. has_sequence_feature A relation linking a sequence feature to the location it occupies on some reference sequence. occupies has_location This document is about information artifacts and their representations A (currently) primitive relation that relates an information artifact to an entity. is_about is a (currently) primitive relation that relates an information artifact to an entity. 7/6/2009 Alan Ruttenberg. Following discussion with Jonathan Rees, and introduction of "mentions" relation. Weaken the is_about relationship to be primitive. We will try to build it back up by elaborating the various subproperties that are more precisely defined. Some currently missing phenomena that should be considered "about" are predications - "The only person who knows the answer is sitting beside me" , Allegory, Satire, and other literary forms that can be topical without explicitly mentioning the topic. person:Alan Ruttenberg Smith, Ceusters, Ruttenberg, 2000 years of philosophy is about is about Denotes is a primitive, instance-level, relation obtaining between an information content entity and some portion of reality. Denotation is what happens when someone creates an information content entity E in order to specifically refer to something. The only relation between E and the thing is that E can be used to 'pick out' the thing. This relation connects those two together. Freedictionary.com sense 3: To signify directly; refer to specifically Consdier if this is the best relation for linking genotypes to the genomic entities they specify. We could use the more generic 'is about', or define a new 'specifies' relation that holds between ICEs and something it specifies the nature or creation of. denotes Mathias Brochhausen This is a primitive relation. This relation is the foundation to the owners right to have the owned entity at his/her full disposal. Reinach, A. Sämtliche Werke. Texkritische Ausgabe, München: Philosophia Verlag, 1989, p.189-204. owns a is owned by b if b has complete power over a. All rights and obligations of ownership are grounded in this (primitive) relation. The claims and obligations of ownership can be partially transferred to a third party by the owner, b. Reinach, A. Sämtliche Werke. Texkritische Ausgabe, München: Philosophia Verlag, 1989, p.189-204. is owned by is_supported_by_data The relation between the conclusion "Gene tpbA is involved in EPS production" and the data items produced using two sets of organisms, one being a tpbA knockout, the other being tpbA wildtype tested in polysacharide production assays and analyzed using an ANOVA. The relation between a data item and a conclusion where the conclusion is the output of a data interpreting process and the data item is used as an input to that process OBI OBI Philly 2011 workshop is_supported_by_data has_specified_input has_specified_input see is_input_of example_of_usage The inverse property of is_specified_input_of 8/17/09: specified inputs of one process are not necessarily specified inputs of a larger process that it is part of. This is in contrast to how 'has participant' works. PERSON: Alan Ruttenberg PERSON: Bjoern Peters PERSON: Larry Hunter PERSON: Melanie Coutot has_specified_input is_specified_input_of some Autologous EBV(Epstein-Barr virus)-transformed B-LCL (B lymphocyte cell line) is_input_for instance of Chromum Release Assay described at https://wiki.cbil.upenn.edu/obiwiki/index.php/Chromium_Release_assay A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of. Alan Ruttenberg PERSON:Bjoern Peters is_specified_input_of has_specified_output has_specified_output The inverse property of is_specified_output_of PERSON: Alan Ruttenberg PERSON: Bjoern Peters PERSON: Larry Hunter PERSON: Melanie Courtot has_specified_output is_specified_output_of is_specified_output_of A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of. Alan Ruttenberg PERSON:Bjoern Peters is_specified_output_of achieves_planned_objective A cell sorting process achieves the objective specification 'material separation objective' This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process. BP, AR, PPPB branch PPPB branch derived modified according to email thread from 1/23/09 in accordince with DT and PPPB branch achieves_planned_objective objective_achieved_by This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process. OBI OBI objective_achieved_by BFO relation takes precedence. We anticipate BFO 2.0 including and defining this relation. When it does, we will obsolete this property and declare it equivalent to the BFO 2.0 relation. is-aggregate-of true inheres in this fragility inheres in this vase this fragility is a characteristic of this vase this red color inheres in this apple this red color is a characteristic of this apple a relation between a specifically dependent continuant (the characteristic) and any other entity (the bearer), in which the characteristic depends on the bearer for its existence. a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence A dependent inheres in its bearer at all times for which the dependent exists. inheres_in Note that this relation was previously called "inheres in", but was changed to be called "characteristic of" because BFO2 uses "inheres in" in a more restricted fashion. This relation differs from BFO2:inheres_in in two respects: (1) it does not impose a range constraint, and thus it allows qualities of processes, as well as of information entities, whereas BFO2 restricts inheres_in to only apply to independent continuants (2) it is declared functional, i.e. something can only be a characteristic of one thing. characteristic of inheres in bearer of this apple is bearer of this red color this vase is bearer of this fragility Inverse of characteristic_of a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence A bearer can have many dependents, and its dependents can exist for different periods of time, but none of its dependents can exist when the bearer does not exist. bearer_of is bearer of bearer of has characteristic has characteristic https://github.com/oborel/obo-relations/pull/284 participates in this blood clot participates in this blood coagulation this input material (or this output material) participates in this process this investigator participates in this investigation a relation between a continuant and a process, in which the continuant is somehow involved in the process a relation between a continuant and a process, in which the continuant is somehow involved in the process participates_in participates in participates in has participant this blood coagulation has participant this blood clot this investigation has participant this investigator this process has participant this input material (or this output material) a relation between a process and a continuant, in which the continuant is somehow involved in the process a relation between a process and a continuant, in which the continuant is somehow involved in the process Has_participant is a primitive instance-level relation between a process, a continuant, and a time at which the continuant participates in some way in the process. The relation obtains, for example, when this particular process of oxygen exchange across this particular alveolar membrane has_participant this particular sample of hemoglobin at this particular time. has_participant http://www.obofoundry.org/ro/#OBO_REL:has_participant http://www.obofoundry.org/ro/#OBO_REL:has_participant has participant has participant A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The journal article (a generically dependent continuant) is concretized as the quality (a specifically dependent continuant), and both depend on that copy of the printed journal (an independent continuant). An investigator reads a protocol and forms a plan to carry out an assay. The plan is a realizable entity (a specifically dependent continuant) that concretizes the protocol (a generically dependent continuant), and both depend on the investigator (an independent continuant). The plan is then realized by the assay (a process). A relationship between a generically dependent continuant and a specifically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants. is concretized as A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The quality (a specifically dependent continuant) concretizes the journal article (a generically dependent continuant), and both depend on that copy of the printed journal (an independent continuant). An investigator reads a protocol and forms a plan to carry out an assay. The plan is a realizable entity (a specifically dependent continuant) that concretizes the protocol (a generically dependent continuant), and both depend on the investigator (an independent continuant). The plan is then realized by the assay (a process). A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant. concretizes this catalysis function is a function of this enzyme a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence A function inheres in its bearer at all times for which the function exists, however the function need not be realized at all the times that the function exists. function_of is function of This relation is modeled after the BFO relation of the same name which was in BFO2, but is used in a more restricted sense - specifically, we model this relation as functional (inherited from characteristic-of). Note that this relation is now removed from BFO2020. function of this red color is a quality of this apple a relation between a quality and an independent continuant (the bearer), in which the quality specifically depends on the bearer for its existence A quality inheres in its bearer at all times for which the quality exists. is quality of quality_of This relation is modeled after the BFO relation of the same name which was in BFO2, but is used in a more restricted sense - specifically, we model this relation as functional (inherited from characteristic-of). Note that this relation is now removed from BFO2020. quality of this investigator role is a role of this person a relation between a role and an independent continuant (the bearer), in which the role specifically depends on the bearer for its existence A role inheres in its bearer at all times for which the role exists, however the role need not be realized at all the times that the role exists. is role of role_of This relation is modeled after the BFO relation of the same name which was in BFO2, but is used in a more restricted sense - specifically, we model this relation as functional (inherited from characteristic-of). Note that this relation is now removed from BFO2020. role of this enzyme has function this catalysis function (more colloquially: this enzyme has this catalysis function) a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence A bearer can have many functions, and its functions can exist for different periods of time, but none of its functions can exist when the bearer does not exist. A function need not be realized at all the times that the function exists. has_function has function this apple has quality this red color a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence A bearer can have many qualities, and its qualities can exist for different periods of time, but none of its qualities can exist when the bearer does not exist. has_quality has quality this person has role this investigator role (more colloquially: this person has this role of investigator) a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence A bearer can have many roles, and its roles can exist for different periods of time, but none of its roles can exist when the bearer does not exist. A role need not be realized at all the times that the role exists. has_role has role a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence has disposition inverse of has disposition This relation is modeled after the BFO relation of the same name which was in BFO2, but is used in a more restricted sense - specifically, we model this relation as functional (inherited from characteristic-of). Note that this relation is now removed from BFO2020. disposition of derives from this cell derives from this parent cell (cell division) this nucleus derives from this parent nucleus (nuclear division) a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity This is a very general relation. More specific relations are preferred when applicable, such as 'directly develops from'. derives_from derives from derives from this parent cell derives into this cell (cell division) this parent nucleus derives into this nucleus (nuclear division) a relation between two distinct material entities, the old entity and the new entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity This is a very general relation. More specific relations are preferred when applicable, such as 'directly develops into'. To avoid making statements about a future that may not come to pass, it is often better to use the backward-looking 'derives from' rather than the forward-looking 'derives into'. derives_into derives into A 'has regulatory component activity' B if A and B are GO molecular functions (GO_0003674), A has_component B and A is regulated by B. dos 2017-05-24T09:30:46Z has regulatory component activity A relationship that holds between a GO molecular function and a component of that molecular function that negatively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is negatively regulated by B. dos 2017-05-24T09:31:01Z By convention GO molecular functions are classified by their effector function. Internal regulatory functions are treated as components. For example, NMDA glutmate receptor activity is a cation channel activity with positive regulatory component 'glutamate binding' and negative regulatory components including 'zinc binding' and 'magnesium binding'. has negative regulatory component activity A relationship that holds between a GO molecular function and a component of that molecular function that positively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is positively regulated by B. dos 2017-05-24T09:31:17Z By convention GO molecular functions are classified by their effector function and internal regulatory functions are treated as components. So, for example calmodulin has a protein binding activity that has positive regulatory component activity calcium binding activity. Receptor tyrosine kinase activity is a tyrosine kinase activity that has positive regulatory component 'ligand binding'. has positive regulatory component activity dos 2017-05-24T09:44:33Z A 'has component activity' B if A is A and B are molecular functions (GO_0003674) and A has_component B. has component activity w 'has process component' p if p and w are processes, w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type. dos 2017-05-24T09:49:21Z has component process dos 2017-09-17T13:52:24Z Process(P2) is directly regulated by process(P1) iff: P1 regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding regulates the kinase activity (P2) of protein B then P1 directly regulates P2. directly regulated by Process(P2) is directly regulated by process(P1) iff: P1 regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding regulates the kinase activity (P2) of protein B then P1 directly regulates P2. Process(P2) is directly regulated by process(P1) iff: P1 regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding regulates the kinase activity (P2) of protein B then P1 directly regulates P2. GOC:dos Process(P2) is directly negatively regulated by process(P1) iff: P1 negatively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding negatively regulates the kinase activity (P2) of protein B then P2 directly negatively regulated by P1. dos 2017-09-17T13:52:38Z directly negatively regulated by Process(P2) is directly negatively regulated by process(P1) iff: P1 negatively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding negatively regulates the kinase activity (P2) of protein B then P2 directly negatively regulated by P1. Process(P2) is directly negatively regulated by process(P1) iff: P1 negatively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding negatively regulates the kinase activity (P2) of protein B then P2 directly negatively regulated by P1. GOC:dos Process(P2) is directly postively regulated by process(P1) iff: P1 positively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding positively regulates the kinase activity (P2) of protein B then P2 is directly postively regulated by P1. dos 2017-09-17T13:52:47Z directly positively regulated by Process(P2) is directly postively regulated by process(P1) iff: P1 positively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding positively regulates the kinase activity (P2) of protein B then P2 is directly postively regulated by P1. Process(P2) is directly postively regulated by process(P1) iff: P1 positively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding positively regulates the kinase activity (P2) of protein B then P2 is directly postively regulated by P1. GOC:dos A 'has effector activity' B if A and B are GO molecular functions (GO_0003674), A 'has component activity' B and B is the effector (output function) of B. Each compound function has only one effector activity. dos 2017-09-22T14:14:36Z This relation is designed for constructing compound molecular functions, typically in combination with one or more regulatory component activity relations. has effector activity A 'has effector activity' B if A and B are GO molecular functions (GO_0003674), A 'has component activity' B and B is the effector (output function) of B. Each compound function has only one effector activity. A 'has effector activity' B if A and B are GO molecular functions (GO_0003674), A 'has component activity' B and B is the effector (output function) of B. Each compound function has only one effector activity. GOC:dos David Osumi-Sutherland X ends_after Y iff: end(Y) before_or_simultaneous_with end(X) ends after David Osumi-Sutherland starts_at_end_of X immediately_preceded_by Y iff: end(X) simultaneous_with start(Y) immediately preceded by David Osumi-Sutherland ends_at_start_of meets X immediately_precedes_Y iff: end(X) simultaneous_with start(Y) immediately precedes x overlaps y if and only if there exists some z such that x has part z and z part of y http://purl.obolibrary.org/obo/BFO_0000051 some (http://purl.obolibrary.org/obo/BFO_0000050 some ?Y) overlaps true x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed. in taxon w 'has component' p if w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type. The definition of 'has component' is still under discussion. The challenge is in providing a definition that does not imply transitivity. For use in recording has_part with a cardinality constraint, because OWL does not permit cardinality constraints to be used in combination with transitive object properties. In situations where you would want to say something like 'has part exactly 5 digit, you would instead use has_component exactly 5 digit. has component p regulates q iff p is causally upstream of q, the execution of p is not constant and varies according to specific conditions, and p influences the rate or magnitude of execution of q due to an effect either on some enabler of q or some enabler of a part of q. Chris Mungall David Hill Tanya Berardini GO Regulation precludes parthood; the regulatory process may not be within the regulated process. regulates (processual) false regulates p negatively regulates q iff p regulates q, and p decreases the rate or magnitude of execution of q. Chris Mungall negatively regulates (process to process) negatively regulates p positively regulates q iff p regulates q, and p increases the rate or magnitude of execution of q. Chris Mungall positively regulates (process to process) positively regulates mechanosensory neuron capable of detection of mechanical stimulus involved in sensory perception (GO:0050974) osteoclast SubClassOf 'capable of' some 'bone resorption' A relation between a material entity (such as a cell) and a process, in which the material entity has the ability to carry out the process. A relation between a material entity (such as a cell) and a process, in which the material entity has the ability to carry out the process. Chris Mungall has function realized in For compatibility with BFO, this relation has a shortcut definition in which the expression "capable of some P" expands to "bearer_of (some realized_by only P)". capable of c stands in this relationship to p if and only if there exists some p' such that c is capable_of p', and p' is part_of p. Chris Mungall has function in capable of part of true Chris Mungall Do not use this relation directly. It is ended as a grouping for relations between occurrents involving the relative timing of their starts and ends. https://docs.google.com/document/d/1kBv1ep_9g3sTR-SD3jqzFqhuwo9TPNF-l-9fUDbO6rM/edit?pli=1 A relation that holds between two occurrents. This is a grouping relation that collects together all the Allen relations. temporally related to p has input c iff: p is a process, c is a material entity, c is a participant in p, c is present at the start of p, and the state of c is modified during p. Chris Mungall consumes has input https://wiki.geneontology.org/Has_input A faulty traffic light (material entity) whose malfunctioning (a process) is causally upstream of a traffic collision (a process): the traffic light acts upstream of the collision. c acts upstream of p if and only if c enables some f that is involved in p' and p' occurs chronologically before p, is not part of p, and affects the execution of p. c is a material entity and f, p, p' are processes. acts upstream of A gene product that has some activity, where that activity may be a part of a pathway or upstream of the pathway. c acts upstream of or within p if c is enables f, and f is causally upstream of or within p. c is a material entity and p is an process. affects acts upstream of or within https://wiki.geneontology.org/Acts_upstream_of_or_within p is causally upstream of, positive effect q iff p is casually upstream of q, and the execution of p is required for the execution of q. cjm holds between x and y if and only if x is causally upstream of y and the progression of x increases the frequency, rate or extent of y causally upstream of, positive effect p is causally upstream of, negative effect q iff p is casually upstream of q, and the execution of p decreases the execution of q. cjm causally upstream of, negative effect q characteristic of part of w if and only if there exists some p such that q inheres in p and p part of w. Because part_of is transitive, inheres in is a sub-relation of characteristic of part of Chris Mungall inheres in part of characteristic of part of true A mereological relationship or a topological relationship Chris Mungall Do not use this relation directly. It is ended as a grouping for a diverse set of relations, all involving parthood or connectivity relationships mereotopologically related to a particular instances of akt-2 enables some instance of protein kinase activity c enables p iff c is capable of p and c acts to execute p. Chris Mungall catalyzes executes has is catalyzing is executing This relation differs from the parent relation 'capable of' in that the parent is weaker and only expresses a capability that may not be actually realized, whereas this relation is always realized. enables https://wiki.geneontology.org/Enables A grouping relationship for any relationship directly involving a function, or that holds because of a function of one of the related entities. Chris Mungall This is a grouping relation that collects relations used for the purpose of connecting structure and function functionally related to this relation holds between c and p when c is part of some c', and c' is capable of p. Chris Mungall false part of structure that is capable of true c involved_in p if and only if c enables some process p', and p' is part of p Chris Mungall actively involved in enables part of involved in https://wiki.geneontology.org/Involved_in inverse of enables Chris Mungall enabled by enabled by https://wiki.geneontology.org/Enabled_by inverse of regulates Chris Mungall regulated by (processual) regulated by inverse of negatively regulates Chris Mungall negatively regulated by inverse of positively regulates Chris Mungall positively regulated by An organism that is a member of a population of organisms is member of is a mereological relation between a item and a collection. is member of member part of SIO is member of member of Example 1: a collection of sequences such as a genome being comprised of separate sequences of chromosomes Example 2: a collection of information entities such as a genotype being comprised of a background component and a variant component has member is a mereological relation between a collection and an item. SIO has member has member inverse of has input Chris Mungall input of inverse of upstream of Chris Mungall causally downstream of Chris Mungall immediately causally downstream of p indirectly positively regulates q iff p is indirectly causally upstream of q and p positively regulates q. Chris Mungall indirectly activates indirectly positively regulates https://wiki.geneontology.org/Indirectly_positively_regulates p indirectly negatively regulates q iff p is indirectly causally upstream of q and p negatively regulates q. Chris Mungall indirectly inhibits indirectly negatively regulates https://wiki.geneontology.org/Indirectly_negatively_regulates relation that links two events, processes, states, or objects such that one event, process, state, or object (a cause) contributes to the production of another event, process, state, or object (an effect) where the cause is partly or wholly responsible for the effect, and the effect is partly or wholly dependent on the cause. This branch of the ontology deals with causal relations between entities. It is divided into two branches: causal relations between occurrents/processes, and causal relations between material entities. We take an 'activity flow-centric approach', with the former as primary, and define causal relations between material entities in terms of causal relations between occurrents. To define causal relations in an activity-flow type network, we make use of 3 primitives: * Temporal: how do the intervals of the two occurrents relate? * Is the causal relation regulatory? * Is the influence positive or negative? The first of these can be formalized in terms of the Allen Interval Algebra. Informally, the 3 bins we care about are 'direct', 'indirect' or overlapping. Note that all causal relations should be classified under a RO temporal relation (see the branch under 'temporally related to'). Note that all causal relations are temporal, but not all temporal relations are causal. Two occurrents can be related in time without being causally connected. We take causal influence to be primitive, elucidated as being such that has the upstream changed, some qualities of the donwstream would necessarily be modified. For the second, we consider a relationship to be regulatory if the system in which the activities occur is capable of altering the relationship to achieve some objective. This could include changing the rate of production of a molecule. For the third, we consider the effect of the upstream process on the output(s) of the downstream process. If the level of output is increased, or the rate of production of the output is increased, then the direction is increased. Direction can be positive, negative or neutral or capable of either direction. Two positives in succession yield a positive, two negatives in succession yield a positive, otherwise the default assumption is that the net effect is canceled and the influence is neutral. Each of these 3 primitives can be composed to yield a cross-product of different relation types. Chris Mungall Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect. causally related to relation that links two events, processes, states, or objects such that one event, process, state, or object (a cause) contributes to the production of another event, process, state, or object (an effect) where the cause is partly or wholly responsible for the effect, and the effect is partly or wholly dependent on the cause. https://en.wikipedia.org/wiki/Causality p is causally upstream of q iff p is causally related to q, the end of p precedes the end of q, and p is not an occurrent part of q. Chris Mungall causally upstream of p is immediately causally upstream of q iff p is causally upstream of q, and the end of p is coincident with the beginning of q. Chris Mungall immediately causally upstream of p is 'causally upstream or within' q iff p is causally related to q, and the end of p precedes, or is coincident with, the end of q. We would like to make this disjoint with 'preceded by', but this is prohibited in OWL2 Chris Mungall influences (processual) affects causally upstream of or within inverse of causally upstream of or within Chris Mungall causally downstream of or within c involved in regulation of p if c is involved in some p' and p' regulates some p Chris Mungall involved in regulation of c involved in regulation of p if c is involved in some p' and p' positively regulates some p Chris Mungall involved in positive regulation of c involved in regulation of p if c is involved in some p' and p' negatively regulates some p Chris Mungall involved in negative regulation of c involved in or regulates p if and only if either (i) c is involved in p or (ii) c is involved in regulation of p OWL does not allow defining object properties via a Union Chris Mungall involved in or reguates involved in or involved in regulation of A relationship that holds between two entities in which the processes executed by the two entities are causally connected. This relation and all sub-relations can be applied to either (1) pairs of entities that are interacting at any moment of time (2) populations or species of entity whose members have the disposition to interact (3) classes whose members have the disposition to interact. Considering relabeling as 'pairwise interacts with' Chris Mungall Note that this relationship type, and sub-relationship types may be redundant with process terms from other ontologies. For example, the symbiotic relationship hierarchy parallels GO. The relations are provided as a convenient shortcut. Consider using the more expressive processual form to capture your data. In the future, these relations will be linked to their cognate processes through rules. RO:0002434 in pairwise interaction with source interacts_with interacts_with interacts with http://purl.obolibrary.org/obo/ro/docs/interaction-relations/ http://purl.obolibrary.org/obo/MI_0914 An interaction relationship in which the two partners are molecular entities that directly physically interact with each other for example via a stable binding interaction or a brief interaction during which one modifies the other. Chris Mungall binds molecularly binds with molecularly interacts with http://purl.obolibrary.org/obo/MI_0915 Axiomatization to GO to be added later Chris Mungall An interaction relation between x and y in which x catalyzes a reaction in which a phosphate group is added to y. phosphorylates The entity A, immediately upstream of the entity B, has an activity that regulates an activity performed by B. For example, A and B may be gene products and binding of B by A regulates the kinase activity of B. A and B can be physically interacting but not necessarily. Immediately upstream means there are no intermediate entity between A and B. Chris Mungall Vasundra Touré molecularly controls directly regulates activity of The entity A, immediately upstream of the entity B, has an activity that negatively regulates an activity performed by B. For example, A and B may be gene products and binding of B by A negatively regulates the kinase activity of B. Chris Mungall Vasundra Touré directly inhibits molecularly decreases activity of directly negatively regulates activity of The entity A, immediately upstream of the entity B, has an activity that positively regulates an activity performed by B. For example, A and B may be gene products and binding of B by A positively regulates the kinase activity of B. Chris Mungall Vasundra Touré directly activates molecularly increases activity of directly positively regulates activity of Chris Mungall This property or its subproperties is not to be used directly. These properties exist as helper properties that are used to support OWL reasoning. helper property (not for use in curation) Chris Mungall is kinase activity A relationship between a material entity and a process where the material entity has some causal role that influences the process causal agent in process p is causally related to q if and only if p or any part of p and q or any part of q are linked by a chain of events where each event pair is one where the execution of p influences the execution of q. p may be upstream, downstream, part of, or a container of q. Chris Mungall Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect. causal relation between processes Chris Mungall depends on The intent is that the process branch of the causal property hierarchy is primary (causal relations hold between occurrents/processes), and that the material branch is defined in terms of the process branch Chris Mungall Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect. causal relation between entities Chris Mungall causally influenced by (entity-centric) causally influenced by Chris Mungall interaction relation helper property http://purl.obolibrary.org/obo/ro/docs/interaction-relations/ Chris Mungall molecular interaction relation helper property The entity or characteristic A is causally upstream of the entity or characteristic B, A having an effect on B. An entity corresponds to any biological type of entity as long as a mass is measurable. A characteristic corresponds to a particular specificity of an entity (e.g., phenotype, shape, size). Chris Mungall Vasundra Touré causally influences (entity-centric) causally influences p directly regulates q iff p is immediately causally upstream of q and p regulates q. Chris Mungall directly regulates (processual) directly regulates gland SubClassOf 'has part structure that is capable of' some 'secretion by cell' s 'has part structure that is capable of' p if and only if there exists some part x such that s 'has part' x and x 'capable of' p Chris Mungall has part structure that is capable of A relationship that holds between a material entity and a process in which causality is involved, with either the material entity or some part of the material entity exerting some influence over the process, or the process influencing some aspect of the material entity. Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect. Chris Mungall causal relation between material entity and a process pyrethroid -> growth Holds between c and p if and only if c is capable of some activity a, and a regulates p. capable of regulating Holds between c and p if and only if c is capable of some activity a, and a negatively regulates p. capable of negatively regulating renin -> arteriolar smooth muscle contraction Holds between c and p if and only if c is capable of some activity a, and a positively regulates p. capable of positively regulating Inverse of 'causal agent in process' process has causal agent p directly positively regulates q iff p is immediately causally upstream of q, and p positively regulates q. directly positively regulates (process to process) directly positively regulates https://wiki.geneontology.org/Directly_positively_regulates p directly negatively regulates q iff p is immediately causally upstream of q, and p negatively regulates q. directly negatively regulates (process to process) directly negatively regulates https://wiki.geneontology.org/Directly_negatively_regulates Holds between an entity and an process P where the entity enables some larger compound process, and that larger process has-part P. cjm 2018-01-25T23:20:13Z enables subfunction cjm 2018-01-26T23:49:30Z acts upstream of or within, positive effect https://wiki.geneontology.org/Acts_upstream_of_or_within,_positive_effect cjm 2018-01-26T23:49:51Z acts upstream of or within, negative effect https://wiki.geneontology.org/Acts_upstream_of_or_within,_negative_effect c 'acts upstream of, positive effect' p if c is enables f, and f is causally upstream of p, and the direction of f is positive cjm 2018-01-26T23:53:14Z acts upstream of, positive effect https://wiki.geneontology.org/Acts_upstream_of,_positive_effect c 'acts upstream of, negative effect' p if c is enables f, and f is causally upstream of p, and the direction of f is negative cjm 2018-01-26T23:53:22Z acts upstream of, negative effect https://wiki.geneontology.org/Acts_upstream_of,_negative_effect cjm 2018-03-13T23:55:05Z causally upstream of or within, negative effect https://wiki.geneontology.org/Causally_upstream_of_or_within,_negative_effect cjm 2018-03-13T23:55:19Z causally upstream of or within, positive effect The entity A has an activity that regulates an activity of the entity B. For example, A and B are gene products where the catalytic activity of A regulates the kinase activity of B. Vasundra Touré regulates activity of p is indirectly causally upstream of q iff p is causally upstream of q and there exists some process r such that p is causally upstream of r and r is causally upstream of q. pg 2022-09-26T06:07:17Z indirectly causally upstream of p indirectly regulates q iff p is indirectly causally upstream of q and p regulates q. pg 2022-09-26T06:08:01Z indirectly regulates A diagnostic testing device utilizes a specimen. X device utilizes material Y means X and Y are material entities, and X is capable of some process P that has input Y. https://orcid.org/0000-0001-9625-1899 https://orcid.org/0000-0003-2620-0345 A diagnostic testing device utilizes a specimen means that the diagnostic testing device is capable of an assay, and this assay a specimen as its input. See github ticket https://github.com/oborel/obo-relations/issues/497 2021-11-08T12:00:00Z 2021-11-08T12:00:00Z utilizes device utilizes material A relationship that holds between a process and a characteristic in which process (P) regulates characteristic (C) iff: P results in the existence of C OR affects the intensity or magnitude of C. regulates characteristic A relationship that holds between a process and a characteristic in which process (P) positively regulates characteristic (C) iff: P results in an increase in the intensity or magnitude of C. positively regulates characteristic A relationship that holds between a process and a characteristic in which process (P) negatively regulates characteristic (C) iff: P results in a decrease in the intensity or magnitude of C. negatively regulates characteristic provideInformationOn providesAccessTo consistOf experimentalContextFor generates uses componentOf funds organizedBy createdBy deployedOn leadTo resultsIn usedIn conductedAt capableOfIdentifying capableOfDetecting contain present sameAs isResultOf aggregate hasRole characterizedBy conductedOn operatesOn quantifiedBy partOf operates operatedBy managedAt managed depicts depictedIn fundedBy funded implements implementedBy owned by owned by owns owns investigates investigatedBy source interacts_with_an_exposure_receptor_via interacts_with_an_exposure_receptor_via source interacts_with_an_exposure_stressor_via interacts_with_an_exposure stressor_via This object property has been mapped address This object property has been deprecated agent true This object property has been mapped email This object property has been mapped geo Used to support property parameters for the additional name data property has additional name To specify the components of the delivery address for the object has address To specify the busy time associated with the object. (Was called FBURL in RFC6350) has calendar busy To specify the calendar associated with the object. (Was called CALURI in RFC6350) has calendar link To specify the calendar user address to which a scheduling request be sent for the object. (Was called CALADRURI in RFC6350) has calendar request Used to support property parameters for the category data property has category Used to support property parameters for the country name data property has country name To specify the electronic mail address for communication with the object has email Used to support property parameters for the formatted name data property has formatted name Used to support property parameters for the family name data property has family name To specify the sex or gender identity of the object. URIs are recommended to enable interoperable sex and gender codes to be used. has gender To specify information related to the global positioning of the object. May also be used as a property parameter. has geo Used to support property parameters for the given name data property has given name Used to support property parameters for the honorific prefix data property has honorific prefix Used to support property parameters for the honorific suffix data property has honorific suffix To specify the instant messaging and presence protocol communications with the object. (Was called IMPP in RFC6350) has messaging To specify a public key or authentication certificate associated with the object has key Used to support property parameters for the language data property has language Used to support property parameters for the locality data property has locality To specify a graphic image of a logo associated with the object has logo To include a member in the group this object represents. (This property can only be used by Group individuals) has member To specify the components of the name of the object has name Used to support property parameters for the nickname data property has nickname Used to support property parameters for the note data property has note Used to support property parameters for the organization name data property has organization name Used to support property parameters for the organization unit name data property has organization unit name To specify an image or photograph information that annotates some aspect of the object has photo Used to support property parameters for the postal code data property has postal code Used to support property parameters for the region data property has region To specify a relationship between another entity and the entity represented by this object has related Used to support property parameters for the role data property has role To specify a digital sound content information that annotates some aspect of the object has sound To identify the source of directory information of the object has source Used to support property parameters for the street address data property has street address To specify the telephone number for telephony communication with the object has telephone Used to support property parameters for the title data property has title To specify a value that represents a globally unique identifier corresponding to the object has uid To specify a uniform resource locator associated with the object has url Used to indicate the resource value of an object property that requires property parameters has value This object property has been mapped key This object property has been mapped logo This object property has been mapped name This object property has been mapped. Use the organization-name data property. organization This object property has been mapped photo This object property has been mapped sound This object property has been mapped telephone This object property has been mapped url A site or end-point that gives access to the distribution of the dataset. Et websted eller endpoint der giver adgang til en repræsentation af datasættet. Umístění či přístupový bod zpřístupňující distribuci datové sady. Un sitio o end-point que da acceso a la distribución de un conjunto de datos. Un sito o end-point che dà accesso alla distribuzione del set di dati. data access service dataadgangstjeneste servicio de acceso de datos servizio di accesso ai dati služba pro přístup k datům New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab tilføjet i DCAT 2.0. A site or end-point that gives access to the distribution of the dataset. Et websted eller endpoint der giver adgang til en repræsentation af datasættet. Umístění či přístupový bod zpřístupňující distribuci datové sady. Un sitio o end-point que da acceso a la distribución de un conjunto de datos. Un sito o end-point che dà accesso alla distribuzione del set di dati. A URL of a resource that gives access to a distribution of the dataset. E.g. landing page, feed, SPARQL endpoint. Use for all cases except a simple download link, in which case downloadURL is preferred. Ceci peut être tout type d'URL qui donne accès à une distribution du jeu de données. Par exemple, un lien à une page HTML contenant un lien au jeu de données, un Flux RSS, un point d'accès SPARQL. Utilisez le lorsque votre catalogue ne contient pas d'information sur quoi il est ou quand ce n'est pas téléchargeable. En URL for en ressource som giver adgang til en repræsentation af datsættet. Fx destinationsside, feed, SPARQL-endpoint. Anvendes i alle sammenhænge undtagen til angivelse af et simpelt download link hvor anvendelse af egenskaben downloadURL foretrækkes. Puede ser cualquier tipo de URL que de acceso a una distribución del conjunto de datos, e.g., página de destino, descarga, URL feed, punto de acceso SPARQL. Esta propriedad se debe usar cuando su catálogo de datos no tiene información sobre donde está o cuando no se puede descargar. URL zdroje, přes které je přístupná distribuce datové sady. Příkladem může být vstupní stránka, RSS kanál či SPARQL endpoint. Použijte ve všech případech kromě URL souboru ke stažení, pro které je lepší použít dcat:downloadURL. Un URL di una risorsa che consente di accedere a una distribuzione del set di dati. Per esempio, pagina di destinazione, feed, endpoint SPARQL. Da utilizzare per tutti i casi, tranne quando si tratta di un semplice link per il download nel qual caso è preferito downloadURL. Μπορεί να είναι οποιουδήποτε είδους URL που δίνει πρόσβαση στη διανομή ενός συνόλου δεδομένων. Π.χ. ιστοσελίδα αρχικής πρόσβασης, μεταφόρτωση, feed URL, σημείο διάθεσης SPARQL. Να χρησιμοποιείται όταν ο κατάλογος δεν περιέχει πληροφορίες εαν πρόκειται ή όχι για μεταφορτώσιμο αρχείο. أي رابط يتيح الوصول إلى البيانات. إذا كان الرابط هو ربط مباشر لملف يمكن تحميله استخدم الخاصية downloadURL データセットの配信にアクセス権を与えるランディング・ページ、フィード、SPARQLエンドポイント、その他の種類の資源。 URL d'accès URL de acceso URL πρόσβασης access address adgangsadresse indirizzo di accesso přístupová adresa رابط وصول アクセスURL adgangsURL A URL of a resource that gives access to a distribution of the dataset. E.g. landing page, feed, SPARQL endpoint. Use for all cases except a simple download link, in which case downloadURL is preferred. Ceci peut être tout type d'URL qui donne accès à une distribution du jeu de données. Par exemple, un lien à une page HTML contenant un lien au jeu de données, un Flux RSS, un point d'accès SPARQL. Utilisez le lorsque votre catalogue ne contient pas d'information sur quoi il est ou quand ce n'est pas téléchargeable. En URL for en ressource som giver adgang til en repræsentation af datsættet. Fx destinationsside, feed, SPARQL-endpoint. Anvendes i alle sammenhænge undtagen til angivelse af et simpelt download link hvor anvendelse af egenskaben downloadURL foretrækkes. Puede ser cualquier tipo de URL que de acceso a una distribución del conjunto de datos, e.g., página de destino, descarga, URL feed, punto de acceso SPARQL. Esta propriedad se debe usar cuando su catálogo de datos no tiene información sobre donde está o cuando no se puede descargar. URL zdroje, přes které je přístupná distribuce datové sady. Příkladem může být vstupní stránka, RSS kanál či SPARQL endpoint. Použijte ve všech případech kromě URL souboru ke stažení, pro které je lepší použít dcat:downloadURL. Un URL di una risorsa che consente di accedere a una distribuzione del set di dati. Per esempio, pagina di destinazione, feed, endpoint SPARQL. Da utilizzare per tutti i casi, tranne quando si tratta di un semplice link per il download nel qual caso è preferito downloadURL. Μπορεί να είναι οποιουδήποτε είδους URL που δίνει πρόσβαση στη διανομή ενός συνόλου δεδομένων. Π.χ. ιστοσελίδα αρχικής πρόσβασης, μεταφόρτωση, feed URL, σημείο διάθεσης SPARQL. Να χρησιμοποιείται όταν ο κατάλογος δεν περιέχει πληροφορίες εαν πρόκειται ή όχι για μεταφορτώσιμο αρχείο. أي رابط يتيح الوصول إلى البيانات. إذا كان الرابط هو ربط مباشر لملف يمكن تحميله استخدم الخاصية downloadURL データセットの配信にアクセス権を与えるランディング・ページ、フィード、SPARQLエンドポイント、その他の種類の資源。 Status: English Definition text modified by DCAT revision team, updated Italian and Czech translation provided, translations for other languages pending. rdfs:label, rdfs:comment and skos:scopeNote have been modified. Non-english versions except for Italian must be updated. El rango es una URL. Si la distribución es accesible solamente través de una página de destino (es decir, si no se conoce una URL de descarga directa), entonces el enlance a la página de destino debe ser duplicado como accessURL en la distribución. Hvis en eller flere distributioner kun er tilgængelige via en destinationsside (dvs. en URL til direkte download er ikke kendt), så bør destinationssidelinket gentages som adgangsadresse for distributionen. If the distribution(s) are accessible only through a landing page (i.e. direct download URLs are not known), then the landing page link should be duplicated as accessURL on a distribution. La valeur est une URL. Si la distribution est accessible seulement au travers d'une page d'atterrissage (c-à-dire on n'ignore une URL de téléchargement direct), alors le lien à la page d'atterrissage doit être dupliqué comee accessURL sur la distribution. Pokud jsou distribuce přístupné pouze přes vstupní stránku (tj. URL pro přímé stažení nejsou známa), pak by URL přístupové stránky mělo být duplikováno ve vlastnosti distribuce accessURL. Se le distribuzioni sono accessibili solo attraverso una pagina web (ad esempio, gli URL per il download diretto non sono noti), allora il link della pagina web deve essere duplicato come accessURL sulla distribuzione. Η τιμή είναι ένα URL. Αν η/οι διανομή/ές είναι προσβάσιμη/ες μόνο μέσω μίας ιστοσελίδας αρχικής πρόσβασης (δηλαδή αν δεν υπάρχουν γνωστές διευθύνσεις άμεσης μεταφόρτωσης), τότε ο σύνδεσμος της ιστοσελίδας αρχικής πρόσβασης πρέπει να αναπαραχθεί ως accessURL σε μία διανομή. 確実にダウンロードでない場合や、ダウンロードかどうかが不明である場合は、downloadURLではなく、accessURLを用いてください。ランディング・ページを通じてしか配信にアクセスできない場合（つまり、直接的なダウンロードURLが不明）は、配信におけるaccessURLとしてランディング・ページのリンクをコピーすべきです（SHOULD）。 A catalog whose contents are of interest in the context of this catalog. Et katalog hvis indhold er relevant i forhold til det aktuelle katalog. Katalog, jehož obsah je v kontextu tohoto katalogu zajímavý. Un catalogo i cui contenuti sono di interesse nel contesto di questo catalogo. Un catálogo cuyo contenido es de interés en el contexto del catálogo que está siendo descripto. catalog catalogo catálogo katalog katalog har delkatalog New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. A catalog whose contents are of interest in the context of this catalog. Et katalog hvis indhold er relevant i forhold til det aktuelle katalog. Katalog, jehož obsah je v kontextu tohoto katalogu zajímavý. Un catalogo i cui contenuti sono di interesse nel contesto di questo catalogo. Un catálogo cuyo contenido es de interés en el contexto del catálogo que está siendo descripto. El formato de la distribución en el que los datos están en forma comprimida, e.g. para reducir el tamaño del archivo a bajar. Formát komprese souboru, ve kterém jsou data poskytována v komprimované podobě, např. ke snížení velikosti souboru ke stažení. Il formato di compressione della distribuzione nel quale i dati sono in forma compressa, ad es. per ridurre le dimensioni del file da scaricare. Kompressionsformatet for distributionen som indeholder data i et komprimeret format, fx for at reducere størrelsen af downloadfilen. The compression format of the distribution in which the data is contained in a compressed form, e.g. to reduce the size of the downloadable file. compression format formato de compresión formato di compressione formát komprese kompressionsformat New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab tilføjet i DCAT 2.0. El formato de la distribución en el que los datos están en forma comprimida, e.g. para reducir el tamaño del archivo a bajar. Formát komprese souboru, ve kterém jsou data poskytována v komprimované podobě, např. ke snížení velikosti souboru ke stažení. Il formato di compressione della distribuzione nel quale i dati sono in forma compressa, ad es. per ridurre le dimensioni del file da scaricare. Kompressionsformatet for distributionen som indeholder data i et komprimeret format, fx for at reducere størrelsen af downloadfilen. The compression format of the distribution in which the data is contained in a compressed form, e.g. to reduce the size of the downloadable file. Denne egenskab kan anvendes når filerne i en distribution er blevet komprimeret, fx i en ZIP-fil. Formatet BØR udtrykkes ved en medietype som defineret i 'IANA media types registry', hvis der optræder en relevant medietype dér: https://www.iana.org/assignments/media-types/. Esta propiedad se debe usar cuando los archivos de la distribución están comprimidos, por ejemplo en un archivo ZIP. El formato DEBERÍA expresarse usando un 'media type', tales como los definidos en el registro IANA de 'media types' https://www.iana.org/assignments/media-types/, si está disponibles. Questa proprietà deve essere utilizzata quando i file nella distribuzione sono compressi, ad es. in un file ZIP. Il formato DOVREBBE essere espresso usando un tipo di media come definito dal registro dei tipi di media IANA https://www.iana.org/assignments/media-types/, se disponibile. Tato vlastnost se použije, když jsou soubory v distribuci komprimovány, např. v ZIP souboru. Formát BY MĚL být vyjádřen pomocí typu média definovaného v registru IANA https://www.iana.org/assignments/media-types/, pokud existuje. This property is to be used when the files in the distribution are compressed, e.g. in a ZIP file. The format SHOULD be expressed using a media type as defined by IANA media types registry https://www.iana.org/assignments/media-types/, if available. Información relevante de contacto para el recurso catalogado. Se recomienda el uso de vCard. Informazioni di contatto rilevanti per la risorsa catalogata. Si raccomanda l'uso di vCard. Relevant contact information for the catalogued resource. Use of vCard is recommended. Relevante kontaktoplysninger for den katalogiserede ressource. Anvendelse af vCard anbefales. Relevantní kontaktní informace pro katalogizovaný zdroj. Doporučuje se použít slovník VCard. Relie un jeu de données à une information de contact utile en utilisant VCard. Συνδέει ένα σύνολο δεδομένων με ένα σχετικό σημείο επικοινωνίας, μέσω VCard. تربط قائمة البيانات بعنوان اتصال موصف باستخدام VCard データセットを、VCardを用いて提供されている適切な連絡先情報にリンクします。 Punto de contacto contact point kontaktní bod kontaktpunkt point de contact punto di contatto σημείο επικοινωνίας عنوان اتصال 窓口 Información relevante de contacto para el recurso catalogado. Se recomienda el uso de vCard. Informazioni di contatto rilevanti per la risorsa catalogata. Si raccomanda l'uso di vCard. Relevant contact information for the catalogued resource. Use of vCard is recommended. Relevante kontaktoplysninger for den katalogiserede ressource. Anvendelse af vCard anbefales. Relevantní kontaktní informace pro katalogizovaný zdroj. Doporučuje se použít slovník VCard. Relie un jeu de données à une information de contact utile en utilisant VCard. Συνδέει ένα σύνολο δεδομένων με ένα σχετικό σημείο επικοινωνίας, μέσω VCard. تربط قائمة البيانات بعنوان اتصال موصف باستخدام VCard データセットを、VCardを用いて提供されている適切な連絡先情報にリンクします。 Status: English Definition text modified by DCAT revision team, Italian, Spanish and Czech translations provided, other translations pending. A collection of data that is listed in the catalog. En samling af data som er opført i kataloget. Kolekce dat, která je katalogizována v katalogu. Relie un catalogue à un jeu de données faisant partie de ce catalogue. Un conjunto de datos que se lista en el catálogo. Una raccolta di dati che è elencata nel catalogo. Συνδέει έναν κατάλογο με ένα σύνολο δεδομένων το οποίο ανήκει στον εν λόγω κατάλογο. تربط الفهرس بقائمة بيانات ضمنه カタログの一部であるデータセット。 conjunto de datos dataset dataset datasæt datová sada jeu de données σύνολο δεδομένων قائمة بيانات データセット datasamling har datasæt A collection of data that is listed in the catalog. En samling af data som er opført i kataloget. Kolekce dat, která je katalogizována v katalogu. Relie un catalogue à un jeu de données faisant partie de ce catalogue. Un conjunto de datos que se lista en el catálogo. Una raccolta di dati che è elencata nel catalogo. Συνδέει έναν κατάλογο με ένα σύνολο δεδομένων το οποίο ανήκει στον εν λόγω κατάλογο. تربط الفهرس بقائمة بيانات ضمنه カタログの一部であるデータセット。 Status: English Definition text modified by DCAT revision team, Italian, Spanish and Czech translation provided, other translations pending. An available distribution of the dataset. Connecte un jeu de données à des distributions disponibles. Dostupná distribuce datové sady. En tilgængelig repræsentation af datasættet. Una distribución disponible del conjunto de datos. Una distribuzione disponibile per il set di dati. Συνδέει ένα σύνολο δεδομένων με μία από τις διαθέσιμες διανομές του. تربط قائمة البيانات بطريقة أو بشكل يسمح الوصول الى البيانات データセットを、その利用可能な配信に接続します。 distribuce distribución distribution distribution distribution distribuzione διανομή توزيع データセット配信 har distribution An available distribution of the dataset. Connecte un jeu de données à des distributions disponibles. Dostupná distribuce datové sady. En tilgængelig repræsentation af datasættet. Una distribución disponible del conjunto de datos. Una distribuzione disponibile per il set di dati. Συνδέει ένα σύνολο δεδομένων με μία από τις διαθέσιμες διανομές του. تربط قائمة البيانات بطريقة أو بشكل يسمح الوصول الى البيانات データセットを、その利用可能な配信に接続します。 Status: English Definition text modified by DCAT revision team, translations pending (except for Italian, Spanish and Czech). Ceci est un lien direct à un fichier téléchargeable en un format donnée. Exple fichier CSV ou RDF. Le format est décrit par les propriétés de distribution dct:format et/ou dcat:mediaType. La URL de un archivo descargable en el formato dato. Por ejemplo, archivo CSV o archivo RDF. El formato se describe con las propiedades de la distribución dct:format y/o dcat:mediaType. Questo è un link diretto al file scaricabile in un dato formato. E.g. un file CSV o un file RDF. Il formato è descritto dal dct:format e/o dal dcat:mediaType della distribuzione. The URL of the downloadable file in a given format. E.g. CSV file or RDF file. The format is indicated by the distribution's dct:format and/or dcat:mediaType. URL souboru ke stažení v daném formátu, například CSV nebo RDF soubor. Formát je popsán vlastností distribuce dct:format a/nebo dcat:mediaType. URL til fil der kan downloades i et bestemt format. Fx en CSV-fil eller en RDF-fil. Formatet for distributionen angives ved hjælp af egenskaberne dct:format og/eller dcat:mediaType. dcat:downloadURLはdcat:accessURLの特定の形式です。しかし、DCATプロファイルが非ダウンロード・ロケーションに対してのみaccessURLを用いる場合には、より強い分離を課すことを望む可能性があるため、この含意を強化しないように、DCATは、dcat:downloadURLをdcat:accessURLのサブプロパティーであると定義しません。 Είναι ένας σύνδεσμος άμεσης μεταφόρτωσης ενός αρχείου σε μια δεδομένη μορφή. Π.χ. ένα αρχείο CSV ή RDF. Η μορφη αρχείου περιγράφεται από τις ιδιότητες dct:format ή/και dcat:mediaType της διανομής. رابط مباشر لملف يمكن تحميله. نوع الملف يتم توصيفه باستخدام الخاصية dct:format dcat:mediaType URL de descarga URL de téléchargement URL di scarico URL souboru ke stažení URL μεταφόρτωσης download URL downloadURL رابط تحميل ダウンロードURL Ceci est un lien direct à un fichier téléchargeable en un format donnée. Exple fichier CSV ou RDF. Le format est décrit par les propriétés de distribution dct:format et/ou dcat:mediaType. La URL de un archivo descargable en el formato dato. Por ejemplo, archivo CSV o archivo RDF. El formato se describe con las propiedades de la distribución dct:format y/o dcat:mediaType. Questo è un link diretto al file scaricabile in un dato formato. E.g. un file CSV o un file RDF. Il formato è descritto dal dct:format e/o dal dcat:mediaType della distribuzione. The URL of the downloadable file in a given format. E.g. CSV file or RDF file. The format is indicated by the distribution's dct:format and/or dcat:mediaType. URL souboru ke stažení v daném formátu, například CSV nebo RDF soubor. Formát je popsán vlastností distribuce dct:format a/nebo dcat:mediaType. URL til fil der kan downloades i et bestemt format. Fx en CSV-fil eller en RDF-fil. Formatet for distributionen angives ved hjælp af egenskaberne dct:format og/eller dcat:mediaType. dcat:downloadURLはdcat:accessURLの特定の形式です。しかし、DCATプロファイルが非ダウンロード・ロケーションに対してのみaccessURLを用いる場合には、より強い分離を課すことを望む可能性があるため、この含意を強化しないように、DCATは、dcat:downloadURLをdcat:accessURLのサブプロパティーであると定義しません。 Είναι ένας σύνδεσμος άμεσης μεταφόρτωσης ενός αρχείου σε μια δεδομένη μορφή. Π.χ. ένα αρχείο CSV ή RDF. Η μορφη αρχείου περιγράφεται από τις ιδιότητες dct:format ή/και dcat:mediaType της διανομής. رابط مباشر لملف يمكن تحميله. نوع الملف يتم توصيفه باستخدام الخاصية dct:format dcat:mediaType Status: English Definition text modified by DCAT revision team, Italian, Spanish and Czech translation updated, other translations pending. rdfs:label, rdfs:comment and/or skos:scopeNote have been modified. Non-english versions must be updated. El valor es una URL. La valeur est une URL. dcat:downloadURL BY MĚLA být použita pro adresu, ze které je distribuce přímo přístupná, typicky skrze požadavek HTTP Get. dcat:downloadURL BØR anvendes til angivelse af den adresse hvor distributionen er tilgængelig direkte, typisk gennem et HTTP Get request. dcat:downloadURL DOVREBBE essere utilizzato per l'indirizzo a cui questa distribuzione è disponibile direttamente, in genere attraverso una richiesta Get HTTP. dcat:downloadURL SHOULD be used for the address at which this distribution is available directly, typically through a HTTP Get request. Η τιμή είναι ένα URL. A description of the service end-point, including its operations, parameters etc. En beskrivelse af det pågældende tjenesteendpoint, inklusiv dets operationer, parametre etc. Popis přístupového bodu služby včetně operací, parametrů apod. Una descripción del end-point del servicio, incluyendo sus operaciones, parámetros, etc. Una descrizione dell'endpoint del servizio, incluse le sue operazioni, parametri, ecc. descripción del end-point del servicio description of service end-point descrizione dell'endpoint del servizio endpointbeskrivelse popis přístupového bodu služby New property in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà in DCAT 2.0. Ny egenskab i DCAT 2.0. A description of the service end-point, including its operations, parameters etc. En beskrivelse af det pågældende tjenesteendpoint, inklusiv dets operationer, parametre etc. Popis přístupového bodu služby včetně operací, parametrů apod. Una descripción del end-point del servicio, incluyendo sus operaciones, parámetros, etc.. Una descrizione dell'endpoint del servizio, incluse le sue operazioni, parametri, ecc. An endpoint description may be expressed in a machine-readable form, such as an OpenAPI (Swagger) description, an OGC GetCapabilities response, a SPARQL Service Description, an OpenSearch or WSDL document, a Hydra API description, else in text or some other informal mode if a formal representation is not possible. En beskrivelse af et endpoint kan udtrykkes i et maskinlæsbart format, såsom OpenAPI (Swagger)-beskrivelser, et OGC GetCapabilities svar, en SPARQL tjenestebeskrivelse, en OpenSearch- eller et WSDL-dokument, en Hydra-API-beskrivelse, eller i tekstformat eller i et andet uformelt format, hvis en formel repræsentation ikke er mulig. Endpointbeskrivelsen giver specifikke oplysninger om den konkrete endpointinstans, mens dct:conformsTo anvendes til at indikere den overordnede standard eller specifikation som endpointet er i overensstemmelse med. La descripción del endpoint brinda detalles específicos de la instancia del endpoint, mientras que dct:conformsTo se usa para indicar el estándar general o especificación que implementa el endpoint. La descrizione dell'endpoint fornisce dettagli specifici dell'istanza dell'endpoint reale, mentre dct:conformsTo viene utilizzato per indicare lo standard o le specifiche implementate dall'endpoint. Popis přístupového bodu dává specifické detaily jeho konkrétní instance, zatímco dct:conformsTo indikuje obecný standard či specifikaci kterou přístupový bod implementuje. Popis přístupového bodu může být vyjádřen ve strojově čitelné formě, například jako popis OpenAPI (Swagger), odpověď služby OGC getCapabilities, pomocí slovníku SPARQL Service Description, jako OpenSearch či WSDL document, jako popis API dle slovníku Hydra, a nebo textově nebo jiným neformálním způsobem, pokud není možno použít formální reprezentaci. The endpoint description gives specific details of the actual endpoint instance, while dct:conformsTo is used to indicate the general standard or specification that the endpoint implements. Una descripción del endpoint del servicio puede expresarse en un formato que la máquina puede interpretar, tal como una descripción basada en OpenAPI (Swagger), una respuesta OGC GetCapabilities, una descripción de un servicio SPARQL, un documento OpenSearch o WSDL, una descripción con la Hydra API, o en texto u otro modo informal si la representación formal no es posible. Una descrizione dell'endpoint può essere espressa in un formato leggibile dalla macchina, come una descrizione OpenAPI (Swagger), una risposta GetCapabilities OGC, una descrizione del servizio SPARQL, un documento OpenSearch o WSDL, una descrizione API Hydra, o con del testo o qualche altra modalità informale se una rappresentazione formale non è possibile. Kořenové umístění nebo hlavní přístupový bod služby (IRI přístupné přes Web). La locazione principale o l'endpoint primario del servizio (un IRI risolvibile via web). La posición raíz o end-point principal del servicio (una IRI web). Rodplaceringen eller det primære endpoint for en tjeneste (en web-resolverbar IRI). The root location or primary endpoint of the service (a web-resolvable IRI). end-point del servicio end-point del servizio přístupový bod služby service end-point tjenesteendpoint New property in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà in DCAT 2.0. Kořenové umístění nebo hlavní přístupový bod služby (IRI přístupné přes Web). La locazione principale o l'endpoint primario del servizio (un IRI risolvibile via web). La posición raíz o end-point principal del servicio (una IRI web). Rodplaceringen eller det primære endpoint for en tjeneste (en web-resolverbar IRI). The root location or primary endpoint of the service (a web-resolvable IRI). Den funktion en entitet eller aktør har i forhold til en anden ressource. Funkce entity či agenta ve vztahu k jiné entitě či zdroji. La función de una entidad o agente con respecto a otra entidad o recurso. La funzione di un'entità o un agente rispetto ad un'altra entità o risorsa. The function of an entity or agent with respect to another entity or resource. haRuolo hadRole havde rolle sehraná role tiene rol New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Den funktion en entitet eller aktør har i forhold til en anden ressource. Funkce entity či agenta ve vztahu k jiné entitě či zdroji. La función de una entidad o agente con respecto a otra entidad o recurso. La funzione di un'entità o un agente rispetto ad un'altra entità o risorsa. The function of an entity or agent with respect to another entity or resource. Agregada en DCAT para complementar prov:hadRole (cuyo uso está limitado a roles en el contexto de una actividad, con dominio prov:Association. Introdotta in DCAT per completare prov:hadRole (il cui uso è limitato ai ruoli nel contesto di un'attività, con il dominio di prov:Association. Introduced into DCAT to complement prov:hadRole (whose use is limited to roles in the context of an activity, with the domain of prov:Association. Introduceret i DCAT for at supplere prov:hadRole (hvis anvendelse er begrænset til roller i forbindelse med en aktivitet med domænet prov:Association). Přidáno do DCAT pro doplnění vlastnosti prov:hadRole (jejíž užití je omezeno na role v kontextu aktivity, s definičním oborem prov:Association). Kan vendes ved kvalificerede krediteringer til at angive en aktørs rolle i forhold en entitet. Det anbefales at værdierne styres som et kontrolleret udfaldsrum med aktørroller, såsom http://registry.it.csiro.au/def/isotc211/CI_RoleCode. May be used in a qualified-attribution to specify the role of an Agent with respect to an Entity. It is recommended that the value be taken from a controlled vocabulary of agent roles, such as http://registry.it.csiro.au/def/isotc211/CI_RoleCode. May be used in a qualified-relation to specify the role of an Entity with respect to another Entity. It is recommended that the value be taken from a controlled vocabulary of entity roles such as: ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode; IANA Registry of Link Relations https://www.iana.org/assignments/link-relation; DataCite metadata schema; MARC relators https://id.loc.gov/vocabulary/relators. Může být použito v kvalifikovaném přiřazení pro specifikaci role Agenta ve vztahu k Entitě. Je doporučeno hodnotu vybrat z řízeného slovníku rolí agentů, jako například http://registry.it.csiro.au/def/isotc211/CI_RoleCode. Může být použito v kvalifikovaném vztahu pro specifikaci role Entity ve vztahu k jiné Entitě. Je doporučeno použít hodnotu z řízeného slovníku rolí entit, jako například ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode, IANA Registry of Link Relations https://www.iana.org/assignments/link-relation, DataCite metadata schema, MARC relators https://id.loc.gov/vocabulary/relators. Puede usarse en una atribución cualificada para especificar el rol de un Agente con respecto a una Entidad. Se recomienda que el valor sea de un vocabulario controlado de roles de agentes, como por ejemplo http://registry.it.csiro.au/def/isotc211/CI_RoleCode. Puede usarse en una atribución cualificada para especificar el rol de una Entidad con respecto a otra Entidad. Se recomienda que su valor se tome de un vocabulario controlado de roles de entidades como por ejemplo: ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode; IANA Registry of Link Relations https://www.iana.org/assignments/link-relation; esquema de metadatos de DataCite; MARC relators https://id.loc.gov/vocabulary/relators. Può essere utilizzata in una relazione qualificata per specificare il ruolo di un'entità rispetto a un'altra entità. Si raccomanda che il valore sia preso da un vocabolario controllato di ruoli di entità come ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode, IANA Registry of Link Relations https://www.iana.org/assignments/link-relation, DataCite metadata schema, o MARC relators https://id.loc.gov/vocabulary/relators. Può essere utilizzato in un'attribuzione qualificata per specificare il ruolo di un agente rispetto a un'entità. Si raccomanda che il valore sia preso da un vocabolario controllato di ruoli di agente, come ad esempio http://registry.it.csiro.au/def/isotc211/CI_RoleCode. A Web page that can be navigated to in a Web browser to gain access to the catalog, a dataset, its distributions and/or additional information. En webside som der kan navigeres til i en webbrowser for at få adgang til kataloget, et datasæt, dets distributioner og/eller yderligere information. Una pagina web che può essere navigata per ottenere l'accesso al catalogo, ad un dataset, alle distribuzioni del dataset e/o ad informazioni addizionali. Una página web que puede ser visitada en un explorador Web para tener acceso el catálogo, un conjunto de datos, sus distribuciones y/o información adicional. Une page Web accessible par un navigateur Web donnant accès au catalogue, un jeu de données, ses distributions et/ou des informations additionnelles. Webová stránka, na kterou lze pro získání přístupu ke katalogu, datové sadě, jejím distribucím a/nebo dalším informacím přistoupit webovým prohlížečem. Μία ιστοσελίδα πλοηγίσιμη μέσω ενός φυλλομετρητή (Web browser) που δίνει πρόσβαση στο σύνολο δεδομένων, τις διανομές αυτού ή/και επιπρόσθετες πληροφορίες. صفحة وب يمكن من خلالها الوصول الى قائمة البيانات أو إلى معلومات إضافية متعلقة بها データセット、その配信および（または）追加情報にアクセスするためにウエブ・ブラウザでナビゲートできるウェブページ。 destinationsside landing page page d'atterrissage pagina di destinazione página de destino vstupní stránka ιστοσελίδα αρχικής πρόσβασης صفحة وصول ランディング・ページ A Web page that can be navigated to in a Web browser to gain access to the catalog, a dataset, its distributions and/or additional information. En webside som en webbrowser kan navigeres til for at få adgang til kataloget, et datasæt, dets distritbutioner og/eller yderligere information. Una pagina web che può essere navigata per ottenere l'accesso al catalogo, ad un dataset, alle distribuzioni del dataset e/o ad informazioni addizionali. Una página web que puede ser visitada en un explorador Web para tener acceso el catálogo, un conjunto de datos, sus distribuciones y/o información adicional. Une page Web accessible par un navigateur Web donnant accès au catalogue, un jeu de données, ses distributions et/ou des informations additionnelles. Webová stránka, na kterou lze pro získání přístupu ke katalogu, datové sadě, jejím distribucím a/nebo dalším informacím přistoupit webovým prohlížečem. Μία ιστοσελίδα πλοηγίσιμη μέσω ενός φυλλομετρητή (Web browser) που δίνει πρόσβαση στο σύνολο δεδομένων, τις διανομές αυτού ή/και επιπρόσθετες πληροφορίες. صفحة وب يمكن من خلالها الوصول الى قائمة البيانات أو إلى معلومات إضافية متعلقة بها データセット、その配信および（または）追加情報にアクセスするためにウエブ・ブラウザでナビゲートできるウェブページ。 Hvis en eller flere distributioner kun er tilgængelige via en destinationsside (dvs. en URL til direkte download er ikke kendt), så bør destinationssidelinket gentages som adgangsadresse for en distribution. If the distribution(s) are accessible only through a landing page (i.e. direct download URLs are not known), then the landing page link should be duplicated as accessURL on a distribution. Pokud je distribuce dostupná pouze přes vstupní stránku, t.j. přímý URL odkaz ke stažení není znám, URL přístupové stránky by mělo být duplikováno ve vlastnosti distribuce accessURL. Se la distribuzione è accessibile solo attraverso una pagina di destinazione (cioè, un URL di download diretto non è noto), il link alla pagina di destinazione deve essere duplicato come accessURL sulla distribuzione. Si la distribución es accesible solamente través de una página de aterrizaje (i.e., no se conoce una URL de descarga directa), entonces el enlance a la página de aterrizaje debe ser duplicado como accessURL sobre la distribución. Si la distribution est seulement accessible à travers une page d'atterrissage (exple. pas de connaissance d'URLS de téléchargement direct ), alors le lien de la page d'atterrissage doit être dupliqué comme accessURL sur la distribution. Αν η/οι διανομή/ές είναι προσβάσιμη/ες μόνο μέσω μίας ιστοσελίδας αρχικής πρόσβασης (δηλαδή αν δεν υπάρχουν γνωστές διευθύνσεις άμεσης μεταφόρτωσης), τότε ο σύνδεσμος της ιστοσελίδας αρχικής πρόσβασης πρέπει να αναπαραχθεί ως accessURL σε μία διανομή. ランディング・ページを通じてしか配信にアクセスできない場合（つまり、直接的なダウンロードURLが不明）には、配信におけるaccessURLとしてランディング・ページのリンクをコピーすべきです（SHOULD）。 Cette propriété doit être utilisée quand c'est définit le type de média de la distribution en IANA, sinon dct:format DOIT être utilisé avec différentes valeurs. Esta propiedad debe ser usada cuando está definido el tipo de media de la distribución en IANA, de otra manera dct:format puede ser utilizado con diferentes valores Il tipo di media della distribuzione come definito da IANA Medietypen for distributionen som den er defineret af IANA. The media type of the distribution as defined by IANA Typ média distribuce definovaný v IANA. Η ιδιότητα αυτή ΘΑ ΠΡΕΠΕΙ να χρησιμοποιείται όταν ο τύπος μέσου μίας διανομής είναι ορισμένος στο IANA, αλλιώς η ιδιότητα dct:format ΔΥΝΑΤΑΙ να χρησιμοποιηθεί με διαφορετικές τιμές. يجب استخدام هذه الخاصية إذا كان نوع الملف معرف ضمن IANA このプロパティーは、配信のメディア・タイプがIANAで定義されているときに使用すべきで（SHOULD）、そうでない場合には、dct:formatを様々な値と共に使用できます（MAY）。 media type medietype tipo de media tipo di media typ média type de média τύπος μέσου نوع الميديا メディア・タイプ Il range di dcat:mediaType è stato ristretto come parte della revisione di DCAT. Obor hodnot dcat:mediaType byl zúžen v této revizi DCAT. The range of dcat:mediaType has been tightened as part of the revision of DCAT. Cette propriété doit être utilisée quand c'est définit le type de média de la distribution en IANA, sinon dct:format DOIT être utilisé avec différentes valeurs. Esta propiedad debe ser usada cuando está definido el tipo de media de la distribución en IANA, de otra manera dct:format puede ser utilizado con diferentes valores. Il tipo di media della distribuzione come definito da IANA. Medietypen for distributionen som den er defineret af IANA. The media type of the distribution as defined by IANA. Typ média distribuce definovaný v IANA. Η ιδιότητα αυτή ΘΑ ΠΡΕΠΕΙ να χρησιμοποιείται όταν ο τύπος μέσου μίας διανομής είναι ορισμένος στο IANA, αλλιώς η ιδιότητα dct:format ΔΥΝΑΤΑΙ να χρησιμοποιηθεί με διαφορετικές τιμές. يجب استخدام هذه الخاصية إذا كان نوع الملف معرف ضمن IANA このプロパティーは、配信のメディア・タイプがIANAで定義されているときに使用すべきで（SHOULD）、そうでない場合には、dct:formatを様々な値と共に使用できます（MAY）。 Status: English Definition text modified by DCAT revision team, Italian and Czech translation provided, other translations pending. Note some inconsistency on def vs. usage. Denne egenskab BØR anvendes hvis distributionens medietype optræder i 'IANA media types registry' https://www.iana.org/assignments/media-types/, ellers KAN egenskaben dct:format anvendes med et andet udfaldsrum. Esta propiedad DEBERÍA usarse cuando el 'media type' de la distribución está definido en el registro IANA de 'media types' https://www.iana.org/assignments/media-types/, de lo contrario, dct:format PUEDE usarse con distintos valores. Questa proprietà DEVE essere usata quando il tipo di media della distribuzione è definito nel registro dei tipi di media IANA https://www.iana.org/assignments/media-types/, altrimenti dct:format PUO 'essere usato con differenti valori. Tato vlastnost BY MĚLA být použita, je-li typ média distribuce definován v registru IANA https://www.iana.org/assignments/media-types/. V ostatních případech MŮŽE být použita vlastnost dct:format s jinými hodnotami. This property SHOULD be used when the media type of the distribution is defined in the IANA media types registry https://www.iana.org/assignments/media-types/, otherwise dct:format MAY be used with different values. Balíčkový formát souboru, ve kterém je jeden či více souborů seskupeno dohromady, např. aby bylo možné stáhnout sadu souvisejících souborů naráz. El formato del archivo en que se agrupan uno o más archivos de datos, e.g. para permitir que un conjunto de archivos relacionados se bajen juntos. Format til pakning af data med henblik på distribution af en eller flere relaterede datafiler der samles til en enhed med henblik på samlet distribution. Il formato di impacchettamento della distribuzione in cui uno o più file di dati sono raggruppati insieme, ad es. per abilitare un insieme di file correlati da scaricare insieme. The package format of the distribution in which one or more data files are grouped together, e.g. to enable a set of related files to be downloaded together. formato de empaquetado formato di impacchettamento formát balíčku packaging format pakkeformat New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab tilføjet i DCAT 2.0. Balíčkový formát souboru, ve kterém je jeden či více souborů seskupeno dohromady, např. aby bylo možné stáhnout sadu souvisejících souborů naráz. El formato del archivo en que se agrupan uno o más archivos de datos, e.g. para permitir que un conjunto de archivos relacionados se bajen juntos. Il formato di impacchettamento della distribuzione in cui uno o più file di dati sono raggruppati insieme, ad es. per abilitare un insieme di file correlati da scaricare insieme. The package format of the distribution in which one or more data files are grouped together, e.g. to enable a set of related files to be downloaded together. Denne egenskab kan anvendes hvis filerne i en distribution er pakket, fx i en TAR-fil, en Frictionless Data Package eller en Bagit-fil. Formatet BØR udtrykkes ved en medietype som defineret i 'IANA media types registry', hvis der optræder en relevant medietype dér: https://www.iana.org/assignments/media-types/. Esta propiedad se debe usar cuando los archivos de la distribución están empaquetados, por ejemplo en un archivo TAR, Frictionless Data Package o Bagit. El formato DEBERÍA expresarse usando un 'media type', tales como los definidos en el registro IANA de 'media types' https://www.iana.org/assignments/media-types/, si está disponibles. Questa proprietà deve essere utilizzata quando i file nella distribuzione sono impacchettati, ad esempio in un file TAR, Frictionless Data Package o Bagit. Il formato DOVREBBE essere espresso utilizzando un tipo di supporto come definito dal registro dei tipi di media IANA https://www.iana.org/assignments/media-types/, se disponibili. Tato vlastnost se použije, když jsou soubory v distribuci zabaleny, např. v souboru TAR, v balíčku Frictionless Data Package nebo v souboru Bagit. Formát BY MĚL být vyjádřen pomocí typu média definovaného v registru IANA https://www.iana.org/assignments/media-types/, pokud existuje. This property to be used when the files in the distribution are packaged, e.g. in a TAR file, a Frictionless Data Package or a Bagit file. The format SHOULD be expressed using a media type as defined by IANA media types registry https://www.iana.org/assignments/media-types/, if available. Enlace a una descripción de la relación con otro recurso. Link a una descrizione di una relazione con un'altra risorsa. Link to a description of a relationship with another resource. Odkaz na popis vztahu s jiným zdrojem. Reference til en beskrivelse af en relation til en anden ressource. Kvalificeret relation kvalifikovaný vztah qualified relation relación calificada relazione qualificata New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab tilføjet i DCAT 2.0. Propiedad nueva añadida en DCAT 2.0. Enlace a una descripción de la relación con otro recurso. Link a una descrizione di una relazione con un'altra risorsa. Link to a description of a relationship with another resource. Odkaz na popis vztahu s jiným zdrojem. Reference til en beskrivelse af en relation til en anden ressource. Introdotta in DCAT per integrare le altre relazioni qualificate di PROV. Introduced into DCAT to complement the other PROV qualified relations. Introduceret i DCAT med henblik på at supplere de øvrige kvalificerede relationer fra PROV. Přidáno do DCAT k doplnění jiných kvalifikovaných vztahů ze slovníku PROV. Se incluyó en DCAT para complementar las relaciones calificadas disponibles en PROV. Anvendes til at referere til en anden ressource hvor relationens betydning er kendt men ikke matcher en af de standardiserede egenskaber fra Dublin Core (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) eller PROV-O-egenskaber (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Použito pro odkazování na jiný zdroj, kde druh vztahu je znám, ale neodpovídá standardním vlastnostem ze slovníku Dublin Core (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) či slovníku PROV-O (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Se usa para asociar con otro recurso para el cuál la naturaleza de la relación es conocida pero no es ninguna de las propiedades que provee el estándar Dublin Core (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) or PROV-O properties (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Used to link to another resource where the nature of the relationship is known but does not match one of the standard Dublin Core properties (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) or PROV-O properties (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Viene utilizzato per associarsi a un'altra risorsa nei casi per i quali la natura della relazione è nota ma non è alcuna delle proprietà fornite dallo standard Dublin Core (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat , dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:require, dct:isRequiredBy) o dalle proprietà fornite da PROV-O (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom , prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). A record describing the registration of a single dataset or data service that is part of the catalog. Describe la registración de un conjunto de datos o un servicio de datos en el catálogo. En post der beskriver registreringen af et enkelt datasæt eller en datatjeneste som er opført i kataloget. Propojuje katalog a jeho záznamy. Relie un catalogue à ses registres. Un record che descrive la registrazione di un singolo set di dati o di un servizio dati che fa parte del catalogo. Záznam popisující registraci jedné datové sady či datové služby jakožto součásti katalogu. Συνδέει έναν κατάλογο με τις καταγραφές του. تربط الفهرس بسجل ضمنه カタログの一部であるカタログ・レコード。 post record record registre registro záznam καταγραφή سجل カタログ・レコード har post A record describing the registration of a single dataset or data service that is part of the catalog. Describe la registración de un conjunto de datos o un servicio de datos en el catálogo. En post der beskriver registreringen af et enkelt datasæt eller en datatjeneste som er opført i kataloget. Propojuje katalog a jeho záznamy. Relie un catalogue à ses registres. Un record che descrive la registrazione di un singolo set di dati o di un servizio dati che fa parte del catalogo. Záznam popisující registraci jedné datové sady či datové služby jakožto součásti katalogu. Συνδέει έναν κατάλογο με τις καταγραφές του. تربط الفهرس بسجل ضمنه カタログの一部であるカタログ・レコード。 Status: English, Italian, Spanish and Czech Definitions modified by DCAT revision team, other translations pending. A collection of data that this DataService can distribute. En samling af data som denne datatjeneste kan distribuere. Kolekce dat, kterou je tato Datová služba schopna poskytnout. Una colección de datos que este Servicio de Datos puede distribuir. Una raccolta di dati che questo DataService può distribuire. datatjeneste for datasæt poskytuje datovou sadu provee conjunto de datos serve set di dati serves dataset distribuerer ekspederer udstiller New property in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà in DCAT 2.0. A collection of data that this DataService can distribute. En samling af data som denne datatjeneste kan distribuere. Kolekce dat, kterou je tato Datová služba schopna poskytnout. Una colección de datos que este Servicio de Datos puede distribuir. Una raccolta di dati che questo DataService può distribuire. A site or endpoint that is listed in the catalog. Et websted eller et endpoint som er opført i kataloget. Umístění či přístupový bod registrovaný v katalogu. Un sitio o 'endpoint' que está listado en el catálogo. Un sito o endpoint elencato nel catalogo. datatjeneste service servicio servizio služba har datatjeneste New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad añadida en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. A site or endpoint that is listed in the catalog. Et websted eller et endpoint som er opført i kataloget. Umístění či přístupový bod registrovaný v katalogu. Un sitio o 'endpoint' que está listado en el catálogo. Un sito o endpoint elencato nel catalogo. A main category of the resource. A resource can have multiple themes. Et centralt emne for ressourcen. En ressource kan have flere centrale emner. Hlavní téma zdroje. Zdroj může mít více témat. La categoria principale della risorsa. Una risorsa può avere più temi. La categoría principal del recurso. Un recurso puede tener varios temas. La catégorie principale de la ressource. Une ressource peut avoir plusieurs thèmes. Η κύρια κατηγορία του συνόλου δεδομένων. Ένα σύνολο δεδομένων δύναται να έχει πολλαπλά θέματα. التصنيف الرئيسي لقائمة البيانات. قائمة البيانات يمكن أن تملك أكثر من تصنيف رئيسي واحد. データセットの主要カテゴリー。データセットは複数のテーマを持つことができます。 emne tema tema theme thème téma Θέμα التصنيف テーマ/カテゴリー tema A main category of the resource. A resource can have multiple themes. Et centralt emne for ressourcen. En ressource kan have flere centrale emner. Hlavní téma zdroje. Zdroj může mít více témat. La categoria principale della risorsa. Una risorsa può avere più temi. La categoría principal del recurso. Un recurso puede tener varios temas. La catégorie principale de la ressource. Une ressource peut avoir plusieurs thèmes. Η κύρια κατηγορία του συνόλου δεδομένων. Ένα σύνολο δεδομένων δύναται να έχει πολλαπλά θέματα. التصنيف الرئيسي لقائمة البيانات. قائمة البيانات يمكن أن تملك أكثر من تصنيف رئيسي واحد. データセットの主要カテゴリー。データセットは複数のテーマを持つことができます。 Status: English Definition text modified by DCAT revision team, all except for Italian and Czech translations are pending. El conjunto de skos:Concepts utilizados para categorizar los recursos están organizados en un skos:ConceptScheme que describe todas las categorías y sus relaciones en el catálogo. Il set di concetti skos usati per categorizzare le risorse sono organizzati in skos:ConceptScheme che descrive tutte le categorie e le loro relazioni nel catalogo. Sada instancí třídy skos:Concept použitá pro kategorizaci zdrojů je organizována do schématu konceptů skos:ConceptScheme, které popisuje všechny kategorie v katalogu a jejich vztahy. Samlingen af begreber (skos:Concept) der anvendes til at emneinddele ressourcer organiseres i et begrebssystem (skos:ConceptScheme) som beskriver alle emnerne og deres relationer i kataloget. The set of skos:Concepts used to categorize the resources are organized in a skos:ConceptScheme describing all the categories and their relations in the catalog. Un ensemble de skos:Concepts utilisés pour catégoriser les ressources sont organisés en un skos:ConceptScheme décrivant toutes les catégories et ses relations dans le catalogue. Το σετ των skos:Concepts που χρησιμοποιείται για να κατηγοριοποιήσει τα σύνολα δεδομένων είναι οργανωμένο εντός ενός skos:ConceptScheme που περιγράφει όλες τις κατηγορίες και τις σχέσεις αυτών στον κατάλογο. データセットを分類するために用いられるskos:Conceptの集合は、カタログのすべてのカテゴリーとそれらの関係を記述しているskos:ConceptSchemeで組織化されます。 El sistema de organización del conocimiento utilizado para clasificar conjuntos de datos de catálogos. Il sistema di organizzazione della conoscenza (KOS) usato per classificare i dataset del catalogo. Le systhème d'ogranisation de connaissances utilisé pour classifier les jeux de données du catalogue. Systém organizace znalostí (KOS) použitý pro klasifikaci datových sad v katalogu. The knowledge organization system (KOS) used to classify catalog's datasets. Vidensorganiseringssystem (KOS) som anvendes til at klassificere datasæt i kataloget. Το σύστημα οργάνωσης γνώσης που χρησιμοποιείται για την κατηγοριοποίηση των συνόλων δεδομένων του καταλόγου. لائحة التصنيفات المستخدمه لتصنيف قوائم البيانات ضمن الفهرس カタログのデータセットを分類するために用いられる知識組織化体系（KOS；knowledge organization system）。 emnetaksonomi tassonomia dei temi taxonomie de thèmes taxonomie témat taxonomía de temas theme taxonomy Ταξινομία θεματικών κατηγοριών. قائمة التصنيفات テーマ temataksonomi El sistema de organización del conocimiento utilizado para clasificar conjuntos de datos de catálogos. Il sistema di organizzazione della conoscenza (KOS) usato per classificare i dataset del catalogo. Le systhème d'ogranisation de connaissances utilisé pour classifier les jeux de données du catalogue. Systém organizace znalostí (KOS) použitý pro klasifikaci datových sad v katalogu. The knowledge organization system (KOS) used to classify catalog's datasets. Vidensorganiseringssystem (KOS) som anvendes til at klassificere datasæt i kataloget. Το σύστημα οργάνωσης γνώσης που χρησιμοποιείται για την κατηγοριοποίηση των συνόλων δεδομένων του καταλόγου. لائحة التصنيفات المستخدمه لتصنيف قوائم البيانات ضمن الفهرس カタログのデータセットを分類するために用いられる知識組織化体系（KOS；knowledge organization system）。 Det anbefales at taksonomien organiseres i et skos:ConceptScheme, skos:Collection, owl:Ontology eller lignende, som giver mulighed for at ethvert medlem af taksonomien kan forsynes med en IRI og udgives som linked-data. It is recommended that the taxonomy is organized in a skos:ConceptScheme, skos:Collection, owl:Ontology or similar, which allows each member to be denoted by an IRI and published as linked-data. Je doporučeno, aby byla taxonomie vyjádřena jako skos:ConceptScheme, skos:Collection, owl:Ontology nebo podobné, aby mohla být každá položka identifikována pomocí IRI a publikována jako propojená data. Se recomienda que la taxonomía se organice como un skos:ConceptScheme, skos:Collection, owl:Ontology o similar, los cuáles permiten que cada miembro se denote con una IRI y se publique como datos enlazados. Si raccomanda che la tassonomia sia organizzata in uno skos:ConceptScheme, skos:Collection, owl:Ontology o simili, che permette ad ogni membro di essere indicato da un IRI e pubblicato come linked-data. This axiom needed so that Protege loads DCAT2 without errors. The time needed to accelerate the vehicle from a given start velocity to a given target velocity.<br/><br/> Typical unit code(s): SEC for seconds<br/><br/> <ul> <li>Note: There are unfortunately no standard unit codes for seconds/0..100 km/h or seconds/0..60 mph. Simply use "SEC" for seconds and indicate the velocities in the <a class="localLink" href="https://schema.org/name">name</a> of the <a class="localLink" href="https://schema.org/QuantitativeValue">QuantitativeValue</a>, or use <a class="localLink" href="https://schema.org/valueReference">valueReference</a> with a <a class="localLink" href="https://schema.org/QuantitativeValue">QuantitativeValue</a> of 0..60 mph or 0..100 km/h to specify the reference speeds.</li> </ul> accelerationTime The ACRISS Car Classification Code is a code used by many car rental companies, for classifying vehicles. ACRISS stands for Association of Car Rental Industry Systems and Standards. acrissCode Length of time to engage in the activity. activityDuration How often one should engage in the activity. activityFrequency Any additional component of the exercise prescription that may need to be articulated to the patient. This may include the order of exercises, the number of repetitions of movement, quantitative distance, progressions over time, etc. additionalVariable A route by which this drug may be administered, e.g. 'oral'. administrationRoute Any precaution, guidance, contraindication, etc. related to consumption of alcohol while taking this drug. alcoholWarning The algorithm or rules to follow to compute the score. algorithm An available dosage strength for the drug. availableStrength Indicates the design and body style of the vehicle (e.g. station wagon, hatchback, etc.). bodyType Any precaution, guidance, contraindication, etc. related to this drug's use by breastfeeding mothers. breastfeedingWarning The available volume for cargo or luggage. For automobiles, this is usually the trunk volume.<br/><br/> Typical unit code(s): LTR for liters, FTQ for cubic foot/feet<br/><br/> Note: You can use <a class="localLink" href="https://schema.org/minValue">minValue</a> and <a class="localLink" href="https://schema.org/maxValue">maxValue</a> to indicate ranges. cargoVolume A data catalog which contains this dataset. catalog The name of a character played in some acting or performing role, i.e. in a PerformanceRole. characterName Description of the absorption and elimination of drugs, including their concentration (pharmacokinetics, pK) and biological effects (pharmacodynamics, pD). clincalPharmacology Description of the absorption and elimination of drugs, including their concentration (pharmacokinetics, pK) and biological effects (pharmacodynamics, pD). clinicalPharmacology An item within a data feed. Data feeds may have many elements. dataFeedElement A dataset contained in this catalog. dataset The range of temporal applicability of a dataset, e.g. for a 2011 census dataset, the year 2011 (in ISO 8601 time interval format). datasetTimeInterval The date of the first registration of the vehicle with the respective public authorities. dateVehicleFirstRegistered A downloadable form of this dataset, at a specific location, in a specific format. This property can be repeated if different variations are available. There is no expectation that different downloadable distributions must contain exactly equivalent information (see also <a href="https://www.w3.org/TR/vocab-dcat-3/#Class:Distribution">DCAT</a> on this point). Different distributions might include or exclude different subsets of the entire dataset, for example. distribution A dosage form in which this drug/supplement is available, e.g. 'tablet', 'suspension', 'injection'. dosageForm The drive wheel configuration, i.e. which roadwheels will receive torque from the vehicle's engine via the drivetrain. driveWheelConfiguration The class of drug this belongs to (e.g., statins). drugClass The CO2 emissions in g/km. When used in combination with a QuantitativeValue, put "g/km" into the unitText property of that value, since there is no UN/CEFACT Common Code for "g/km". emissionsCO2 Any precaution, guidance, contraindication, etc. related to consumption of specific foods while taking this drug. foodWarning The capacity of the fuel tank or in the case of electric cars, the battery. If there are multiple components for storage, this should indicate the total of all storage of the same type.<br/><br/> Typical unit code(s): LTR for liters, GLL of US gallons, GLI for UK / imperial gallons, AMH for ampere-hours (for electrical vehicles). fuelCapacity The amount of fuel consumed for traveling a particular distance or temporal duration with the given vehicle (e.g. liters per 100 km).<br/><br/> <ul> <li>Note 1: There are unfortunately no standard unit codes for liters per 100 km. Use <a class="localLink" href="https://schema.org/unitText">unitText</a> to indicate the unit of measurement, e.g. L/100 km.</li> <li>Note 2: There are two ways of indicating the fuel consumption, <a class="localLink" href="https://schema.org/fuelConsumption">fuelConsumption</a> (e.g. 8 liters per 100 km) and <a class="localLink" href="https://schema.org/fuelEfficiency">fuelEfficiency</a> (e.g. 30 miles per gallon). They are reciprocal.</li> <li>Note 3: Often, the absolute value is useful only when related to driving speed ("at 80 km/h") or usage pattern ("city traffic"). You can use <a class="localLink" href="https://schema.org/valueReference">valueReference</a> to link the value for the fuel consumption to another value.</li> </ul> fuelConsumption The distance traveled per unit of fuel used; most commonly miles per gallon (mpg) or kilometers per liter (km/L).<br/><br/> <ul> <li>Note 1: There are unfortunately no standard unit codes for miles per gallon or kilometers per liter. Use <a class="localLink" href="https://schema.org/unitText">unitText</a> to indicate the unit of measurement, e.g. mpg or km/L.</li> <li>Note 2: There are two ways of indicating the fuel consumption, <a class="localLink" href="https://schema.org/fuelConsumption">fuelConsumption</a> (e.g. 8 liters per 100 km) and <a class="localLink" href="https://schema.org/fuelEfficiency">fuelEfficiency</a> (e.g. 30 miles per gallon). They are reciprocal.</li> <li>Note 3: Often, the absolute value is useful only when related to driving speed ("at 80 km/h") or usage pattern ("city traffic"). You can use <a class="localLink" href="https://schema.org/valueReference">valueReference</a> to link the value for the fuel economy to another value.</li> </ul> fuelEfficiency A hospital with which the physician or office is affiliated. hospitalAffiliation A data catalog which contains this dataset (this property was previously 'catalog', preferred name is now 'includedInDataCatalog'). includedDataCatalog A data catalog which contains this dataset. includedInDataCatalog The insurance plans that cover this drug. includedInHealthInsurancePlan Quantitative measure gauging the degree of force involved in the exercise, for example, heartbeats per minute. May include the velocity of the movement. intensity Another drug that is known to interact with this drug in a way that impacts the effect of this drug or causes a risk to the patient. Note: disease interactions are typically captured as contraindications. interactingDrug True if the drug is available in a generic form (regardless of name). isAvailableGenerically A textual description of known damages, both repaired and unrepaired. knownVehicleDamages Link to the drug's label details. labelDetails Indicates the relationship type of a Web link. linkRelationship Indicates that the vehicle meets the respective emission standard. meetsEmissionStandard The total distance travelled by the particular vehicle since its initial production, as read from its odometer.<br/><br/> Typical unit code(s): KMT for kilometers, SMI for statute miles mileageFromOdometer The release date of a vehicle model (often used to differentiate versions of the same make and model). modelDate A position played, performed or filled by a person or organization, as part of an organization. For example, an athlete in a SportsTeam might play in the position named 'Quarterback'. namedPosition The number or type of airbags in the vehicle. numberOfAirbags The number of axles.<br/><br/> Typical unit code(s): C62 numberOfAxles The number of doors.<br/><br/> Typical unit code(s): C62 numberOfDoors The total number of forward gears available for the transmission system of the vehicle.<br/><br/> Typical unit code(s): C62 numberOfForwardGears The number of owners of the vehicle, including the current one.<br/><br/> Typical unit code(s): C62 numberOfPreviousOwners A number associated with a role in an organization, for example, the number on an athlete's jersey. numberedPosition The vasculature the lymphatic structure originates, or afferents, from. originatesFrom Any information related to overdose on a drug, including signs or symptoms, treatments, contact information for emergency response. overdosage The permitted weight of passengers and cargo, EXCLUDING the weight of the empty vehicle.<br/><br/> Typical unit code(s): KGM for kilogram, LBR for pound<br/><br/> <ul> <li>Note 1: Many databases specify the permitted TOTAL weight instead, which is the sum of <a class="localLink" href="https://schema.org/weight">weight</a> and <a class="localLink" href="https://schema.org/payload">payload</a></li> <li>Note 2: You can indicate additional information in the <a class="localLink" href="https://schema.org/name">name</a> of the <a class="localLink" href="https://schema.org/QuantitativeValue">QuantitativeValue</a> node.</li> <li>Note 3: You may also link to a <a class="localLink" href="https://schema.org/QualitativeValue">QualitativeValue</a> node that provides additional information using <a class="localLink" href="https://schema.org/valueReference">valueReference</a>.</li> <li>Note 4: Note that you can use <a class="localLink" href="https://schema.org/minValue">minValue</a> and <a class="localLink" href="https://schema.org/maxValue">maxValue</a> to indicate ranges.</li> </ul> payload Pregnancy category of this drug. pregnancyCategory Any precaution, guidance, contraindication, etc. related to this drug's use during pregnancy. pregnancyWarning Link to prescribing information for the drug. prescribingInfo Indicates the status of drug prescription, e.g. local catalogs classifications or whether the drug is available by prescription or over-the-counter, etc. prescriptionStatus Strength of the guideline's recommendation (e.g. 'class I'). recommendationStrength Any other drug related to this one, for example commonly-prescribed alternatives. relatedDrug Number of times one should repeat the activity. repetitions How often one should break from the activity. restPeriods A role played, performed or filled by a person or organization. For example, the team of creators for a comic book might fill the roles named 'inker', 'penciller', and 'letterer'; or an athlete in a SportsTeam might play in the position named 'Quarterback'. roleName The permitted total weight of cargo and installations (e.g. a roof rack) on top of the vehicle.<br/><br/> Typical unit code(s): KGM for kilogram, LBR for pound<br/><br/> <ul> <li>Note 1: You can indicate additional information in the <a class="localLink" href="https://schema.org/name">name</a> of the <a class="localLink" href="https://schema.org/QuantitativeValue">QuantitativeValue</a> node.</li> <li>Note 2: You may also link to a <a class="localLink" href="https://schema.org/QualitativeValue">QualitativeValue</a> node that provides additional information using <a class="localLink" href="https://schema.org/valueReference">valueReference</a></li> <li>Note 3: Note that you can use <a class="localLink" href="https://schema.org/minValue">minValue</a> and <a class="localLink" href="https://schema.org/maxValue">maxValue</a> to indicate ranges.</li> </ul> roofLoad The vasculature the lymphatic structure runs, or efferents, to. runsTo The RxCUI drug identifier from RXNORM. rxcui The number of persons that can be seated (e.g. in a vehicle), both in terms of the physical space available, and in terms of limitations set by law.<br/><br/> Typical unit code(s): C62 for persons seatingCapacity The speed range of the vehicle. If the vehicle is powered by an engine, the upper limit of the speed range (indicated by <a class="localLink" href="https://schema.org/maxValue">maxValue</a>) should be the maximum speed achievable under regular conditions.<br/><br/> Typical unit code(s): KMH for km/h, HM for mile per hour (0.447 04 m/s), KNT for knot<br/><br/> *Note 1: Use <a class="localLink" href="https://schema.org/minValue">minValue</a> and <a class="localLink" href="https://schema.org/maxValue">maxValue</a> to indicate the range. Typically, the minimal value is zero. * Note 2: There are many different ways of measuring the speed range. You can link to information about how the given value has been determined using the <a class="localLink" href="https://schema.org/valueReference">valueReference</a> property. speed The position of the steering wheel or similar device (mostly for cars). steeringPosition Specifics about the observational study design (enumerated). studyDesign The type of tissue sample required for the test. tissueSample The permitted vertical load (TWR) of a trailer attached to the vehicle. Also referred to as Tongue Load Rating (TLR) or Vertical Load Rating (VLR).<br/><br/> Typical unit code(s): KGM for kilogram, LBR for pound<br/><br/> <ul> <li>Note 1: You can indicate additional information in the <a class="localLink" href="https://schema.org/name">name</a> of the <a class="localLink" href="https://schema.org/QuantitativeValue">QuantitativeValue</a> node.</li> <li>Note 2: You may also link to a <a class="localLink" href="https://schema.org/QualitativeValue">QualitativeValue</a> node that provides additional information using <a class="localLink" href="https://schema.org/valueReference">valueReference</a>.</li> <li>Note 3: Note that you can use <a class="localLink" href="https://schema.org/minValue">minValue</a> and <a class="localLink" href="https://schema.org/maxValue">maxValue</a> to indicate ranges.</li> </ul> tongueWeight The permitted weight of a trailer attached to the vehicle.<br/><br/> Typical unit code(s): KGM for kilogram, LBR for pound * Note 1: You can indicate additional information in the <a class="localLink" href="https://schema.org/name">name</a> of the <a class="localLink" href="https://schema.org/QuantitativeValue">QuantitativeValue</a> node. * Note 2: You may also link to a <a class="localLink" href="https://schema.org/QualitativeValue">QualitativeValue</a> node that provides additional information using <a class="localLink" href="https://schema.org/valueReference">valueReference</a>. * Note 3: Note that you can use <a class="localLink" href="https://schema.org/minValue">minValue</a> and <a class="localLink" href="https://schema.org/maxValue">maxValue</a> to indicate ranges. trailerWeight The variableMeasured property can indicate (repeated as necessary) the variables that are measured in some dataset, either described as text or as pairs of identifier and description using PropertyValue. variableMeasured Originally named <a class="localLink" href="https://schema.org/variablesMeasured">variablesMeasured</a>, the <a class="localLink" href="https://schema.org/variableMeasured">variableMeasured</a> property can indicate (repeated as necessary) the variables that are measured in some dataset, either described as text or as pairs of identifier and description using PropertyValue. variablesMeasured A short text indicating the configuration of the vehicle, e.g. '5dr hatchback ST 2.5 MT 225 hp' or 'limited edition'. vehicleConfiguration Information about the engine or engines of the vehicle. vehicleEngine The Vehicle Identification Number (VIN) is a unique serial number used by the automotive industry to identify individual motor vehicles. vehicleIdentificationNumber The color or color combination of the interior of the vehicle. vehicleInteriorColor The type or material of the interior of the vehicle (e.g. synthetic fabric, leather, wood, etc.). While most interior types are characterized by the material used, an interior type can also be based on vehicle usage or target audience. vehicleInteriorType The release date of a vehicle model (often used to differentiate versions of the same make and model). vehicleModelDate The number of passengers that can be seated in the vehicle, both in terms of the physical space available, and in terms of limitations set by law.<br/><br/> Typical unit code(s): C62 for persons. vehicleSeatingCapacity Indicates whether the vehicle has been used for special purposes, like commercial rental, driving school, or as a taxi. The legislation in many countries requires this information to be revealed when offering a car for sale. vehicleSpecialUsage The type of component used for transmitting the power from a rotating power source to the wheels or other relevant component(s) ("gearbox" for cars). vehicleTransmission Any FDA or other warnings about the drug (text or URL). warning The permitted total weight of the loaded vehicle, including passengers and cargo and the weight of the empty vehicle.<br/><br/> Typical unit code(s): KGM for kilogram, LBR for pound<br/><br/> <ul> <li>Note 1: You can indicate additional information in the <a class="localLink" href="https://schema.org/name">name</a> of the <a class="localLink" href="https://schema.org/QuantitativeValue">QuantitativeValue</a> node.</li> <li>Note 2: You may also link to a <a class="localLink" href="https://schema.org/QualitativeValue">QualitativeValue</a> node that provides additional information using <a class="localLink" href="https://schema.org/valueReference">valueReference</a>.</li> <li>Note 3: Note that you can use <a class="localLink" href="https://schema.org/minValue">minValue</a> and <a class="localLink" href="https://schema.org/maxValue">maxValue</a> to indicate ranges.</li> </ul> weightTotal The distance between the centers of the front and rear wheels.<br/><br/> Typical unit code(s): CMT for centimeters, MTR for meters, INH for inches, FOT for foot/feet wheelbase Quantitative measure of the physiologic output of the exercise; also referred to as energy expenditure. workload Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. 'atgcagctagctaccgtcgatcg'). has_string Describes the number of members in some set. has_count In GENO, this is used to describe things like the number of sequence features comprising a 'sequence feature set', the number of sequences in a 'biological sequence set', or the number of functional sequences defining a particular 'functional copy number complement'. has_member_count This alphanumeric string is generated at data acquisition, and is used to uniquely identify the dataset. NASA Life Sciences Portal Dataset Catalog dataset_catalog dataset catalog id This alphanumeric string is generated at data acquisition, and is used to uniquely identify the dataset. https://github.com/nasa/LSDAO ALSDA subject ID: Unique numeric identifier of a group to which the subject belongs. Examples of subject groups (Flight/Ground Control/Basal) NASA Life Sciences Portal From Subject Number ALSDA Subject ID subject_id subject id ALSDA subject ID: Unique numeric identifier of a group to which the subject belongs. Examples of subject groups (Flight/Ground Control/Basal) https://github.com/nasa/LSDAO The UID assigned by NBISC and used in the Ames Life Science Data Archive NASA Life Sciences Portal Bio ID ALSDA Biospecimen ID bio_id bio ID The UID assigned by NBISC and used in the Ames Life Science Data Archive https://github.com/nasa/LSDAO Original document number assigned by the JSC or ARC project, mission level offices, or headquarters level offices. For publication citations only, this is a number generated by the SQL database. NASA Life Sciences Portal Document Number document_number document number Original document number assigned by the JSC or ARC project, mission level offices, or headquarters level offices. For publication citations only, this is a number generated by the SQL database. https://github.com/nasa/LSDAO Multicellular, connected anatomical structure that has multiple organs as parts and whose parts work together to achieve some shared function. NASA Life Sciences Portal Biospecimen Category Biospecimen Category category biospecimen category Multicellular, connected anatomical structure that has multiple organs as parts and whose parts work together to achieve some shared function. equivalent or subproperty of http://purl.obolibrary.org/obo/UBERON_0000467 Date when data are released (usually by the PI) to the archive, or released to go on the public Website. NASA Life Sciences Portal Release Date release_date release date Date when data are released (usually by the PI) to the archive, or released to go on the public Website. https://github.com/nasa/LSDAO Magnitude of the temporal extent between the start of mission operations and the end of mission operations NASA Life Sciences Portal Duration duration duration Magnitude of the temporal extent between the start of mission operations and the end of mission operations Specified from the definition of http://purl.obolibrary.org/obo/PATO_0001309 A short title assigned to the study NASA Life Sciences Portal Alternate Experiment Name(s) experiment_alias alternate experiment name A short title assigned to the study https://github.com/nasa/LSDAO NASA Life Sciences Portal keyword This value denotes whether a dataset is available for download on the public site. Datasets are either available for download on-line, or available off-line in hardcopy form. NASA Life Sciences Portal Dataset Availability dataset availability Available; Availability dataset availability This value denotes whether a dataset is available for download on the public site. Datasets are either available for download on-line, or available off-line in hardcopy form. https://github.com/nasa/LSDAO The family name associated with the object NASA Life Sciences Portal Last Name lname last name The family name associated with the object owl:equivalentProperty IRI: http://www.w3.org/2006/vcard/ns#family-name Phylogenetic classification of the subject or biospecimen host. Examples include: Homo sapiens, Mus musculus NASA Life Sciences Portal Subject Science Name Type subject_sci_name Taxon Phylogenetic classification of the subject or biospecimen host. Examples include: Homo sapiens, Mus musculus https://github.com/nasa/LSDAO A textual entity refers to a taxon or organism that is based on the normal language of everyday life; this kind of name is often contrasted with the scientific name for the same organism, which is Latinized. NASA Life Sciences Portal Subject Species Common name subject_species Common name A textual entity refers to a taxon or organism that is based on the normal language of everyday life; this kind of name is often contrasted with the scientific name for the same organism, which is Latinized. http://purl.obolibrary.org/obo/OBI_0003074 Typically, a Title will be a name by which the resource is formally known. cf IAO:0000305 document title as a class NASA Life Sciences Portal Document Title document_title document title Typically, a Title will be a name by which the resource is formally known. cf IAO:0000305 document title as a class equiv to http://purl.org/dc/elements/1.1/title Experimental group that a subject belongs to (fixed choice: F, B, GC, V, etc.) NASA Life Sciences Portal Session Type Experimental Group session_type session type Experimental group that a subject belongs to (fixed choice: F, B, GC, V, etc.) https://github.com/nasa/LSDAO NASA Life Sciences Portal hardware_description hardware description Identifier for NASA's research announcements or other "calls for proposals" (i.e. AO, NRA, etc.) soliciting the experiment NASA Life Sciences Portal Proposal Source proposal_source proposal source Identifier for NASA's research announcements or other "calls for proposals" (i.e. AO, NRA, etc.) soliciting the experiment https://github.com/nasa/LSDAO NASA Life Sciences Portal Mission ID mission_id mission id This field refers to the NASA classification of the experiment, in terms of the type of research project it originated from and/or is currently under (i.e AG, LSAH, CEVP), the type of payload or experiment it is, and/or the type of program it is related to. NASA Life Sciences Portal Experiment Type experiment_type_lk experiment type This field refers to the NASA classification of the experiment, in terms of the type of research project it originated from and/or is currently under (i.e AG, LSAH, CEVP), the type of payload or experiment it is, and/or the type of program it is related to. https://github.com/nasa/LSDAO NASA Life Sciences Portal duration range duration_range durationRange The unique identifier assigned to each study NASA Life Sciences Portal Experiment ID experiment_id experiment id The unique identifier assigned to each study http://purl.org/dc/terms/identifier The given name associated with the object NASA Life Sciences Portal First Name fname first name The given name associated with the object http://www.w3.org/2006/vcard/ns#given-name A textual entity that specifies characteristics of some entity. cf. apollosv:00000476 NASA Life Sciences Portal description NASA Life Sciences Portal image id Indicates the material obtained from an organism in order to be a representative of the whole NASA Life Sciences Portal Biospecimen Name Type bio_name biospecimen name Indicates the material obtained from an organism in order to be a representative of the whole http://purl.obolibrary.org/obo/OBI_0000671 A human-readable version of this object synonymous with rdfs:label as applied to institution NASA Life Sciences Portal institution name A human-readable version of this object rdfs label (see https://www.w3.org/TR/rdf-schema/#ch_label) An organismal quality inhering in a bearer by virtue of the bearer's physical expression of sexual characteristics. cf. ExO:0000102 sex NASA Life Sciences Portal Gender Sex gender gender An organismal quality inhering in a bearer by virtue of the bearer's physical expression of sexual characteristics. cf. ExO:0000102 sex http://purl.obolibrary.org/obo/PATO_0001894 NASA Life Sciences Portal Launch Date land_date launch date NASA Life Sciences Portal per_id NASA Life Sciences Portal payload_title payload title The official name given to a study - usually the same name used when responding to a solicitation Experiment Title experiment_title experiment title The official name given to a study - usually the same name used when responding to a solicitation http://purl.org/dc/terms/title NASA Life Sciences Portal Land Date launch_date land date NASA Life Sciences Portal NASA Center Code nasa_center_code nasa center code An account of the content of the resource. NASA Life Sciences Portal Document Description document_description document description An account of the content of the resource. equiv to http://purl.org/dc/terms/description The proposed and/or actual start date of the experiment. NASA Life Sciences Portal Proposal Date proposal_date proposal date NASA Life Sciences Portal component name NASA Life Sciences Portal configuration_description NASA Life Sciences Portal Hardware Type hardware_type hardware type The city or town associated with the address of the object. cf. vcard:locality NASA Life Sciences Portal city The city or town associated with the address of the object. cf. vcard:locality owl:equivalentProperty http://www.w3.org/2006/vcard/ns#locality NASA Life Sciences Portal config_name configuration name owl:equivalentProperty http://purl.obolibrary.org/obo/NCIT_C91820 NASA Life Sciences Portal file thumbnail owl:equivalentProperty http://purl.obolibrary.org/obo/NCIT_C91820 A small image that is representative of a larger image file. The name (or part of a name) of a file (of any type) NASA Life Sciences Portal File Name file_name file name The name (or part of a name) of a file (of any type) owl:equivalentProperty http://edamontology.org/data_1050 These are the Medical Subject Headings (MeSH) terms assigned by LSDA archivists to the experiment. NASA Life Sciences Portal Keywords keywords keywords These are the Medical Subject Headings (MeSH) terms assigned by LSDA archivists to the experiment. https://github.com/nasa/LSDAO NASA Life Sciences Portal Middle Name mname middle name Programmatic, or data acquisition or data quality information regarding this dataset. NASA Life Sciences Portal Dataset Review dataset_review review Programmatic, or data acquisition or data quality information regarding this dataset. https://github.com/nasa/LSDAO NASA Life Sciences Portal Tissue Medium tissue_medium tissue medium A device used to preserve and store specimen (fixed choice: 2ml cryotube, etc.). NASA Life Sciences Portal Container Size Container size container_size container size A device used to preserve and store specimen (fixed choice: 2ml cryotube, etc.). http://purl.obolibrary.org/obo/OBI_0002088 NASA center of the biospecimen NASA Life Sciences Portal Biospecimen Center center_data_entered biospecimen center Date of euthanasia for animals. Can be the same day as dissection. Date of sample harvest for other type of experiments. . NASA Life Sciences Portal Collection Day Date of euthanasia or sample collection CollectionDayDisplay collection day Date of euthanasia for animals. Can be the same day as dissection. Date of sample harvest for other type of experiments. . ttp://purl.obolibrary.org/obo/OBI_0002471 NASA Life Sciences Portal Component Image component image NASA Life Sciences Portal Component Image Size component image size Physical location where the data was collected NASA Life Sciences Portal Data Collection Site DataCollectionSite data collection site Physical location where the data was collected https://github.com/nasa/LSDAO NASA Life Sciences Portal Protocol/Approach protocol_approach protocol approach NASA Life Sciences Portal Processing Level ProcessingLevel processing level The mechanical equipment component used. NASA Life Sciences Portal Hardware Name hardware_name hardware_name The mechanical equipment component used. https://github.com/nasa/LSDAO Describes the information, in terms of the group responsible for collecting and/or providing the data. NASA Life Sciences Portal Data Source DataSource data source Describes the information, in terms of the group responsible for collecting and/or providing the data. https://github.com/nasa/LSDAO The physical or digital form in which the data are available. NASA Life Sciences Portal Dataset Medium dataset_medium dataset medium The physical or digital form in which the data are available. https://github.com/nasa/LSDAO An entity responsible for making the resource. NASA Life Sciences Portal creator creator creator An entity responsible for making the resource. equiv to http://purl.org/dc/terms/creator NASA center or other location where the document is archived; for hardcopy documents, this field also indicates where the document can be ordered NASA Life Sciences Portal location location (archive/request) NASA center or other location where the document is archived; for hardcopy documents, this field also indicates where the document can be ordered https://github.com/nasa/LSDAO Date (often a range) that the resource will become or did become available. NASA Life Sciences Portal Publication Date publication_date publication date Date (often a range) that the resource will become or did become available. equiv to http://purl.org/dc/terms/available NASA Life Sciences Portal Document Type type type Access restrictions for ordering/receiving the archived document. NASA Life Sciences Portal Document Availability document availability document availability Access restrictions for ordering/receiving the archived document. https://github.com/nasa/LSDAO NASA Life Sciences Portal S3 File GUID __s3_file_guid s3 file GUID File name for document available for online. NASA Life Sciences Portal File name filename document filename File name for document available for online. https://github.com/nasa/LSDAO Defines the progress toward completion of archiving an experiment record, or other status information NASA Life Sciences Portal Data Preservation Status archive_status data preservation status Defines the progress toward completion of archiving an experiment record, or other status information https://github.com/nasa/LSDAO Designates the NASA center assigned to preserving and curating an experiment's data and metadata. Note that It is not necessarily the same as the managing center. NASA Life Sciences Portal Archiving NASA Center nasa_center archiving NASA center Designates the NASA center assigned to preserving and curating an experiment's data and metadata. Note that It is not necessarily the same as the managing center. https://github.com/nasa/LSDAO Indicates the agency that is funding (sponsoring) the experiment. NASA Life Sciences Portal agency agency agency Indicates the agency that is funding (sponsoring) the experiment. https://github.com/nasa/LSDAO NASA Life Sciences Portal Discipline discipline discipline Designates the research announcement (aka NRA) under which the study was funded. NASA Life Sciences Portal Task Solicitation task_solicitation task solicitation NASA Life Sciences Portal Species species species NASA Life Sciences Portal Parameter(s) parameter_html parameter NASA Life Sciences Portal Hardware Alias hardware_alias hardware alias NASA Life Sciences Portal Payload ID payload_id payload ID NASA Life Sciences Portal Image Description image_description image description NASA Life Sciences Portal S3 File GUID __s3_file_guid s3 file guid NASA Life Sciences Portal Image Name image_name image name NASA Life Sciences Portal File Type _file_extension file extension NASA Life Sciences Portal file type Provides general spatial information on the environment of the mission's activities. This includes vehicle namess, crewed or uncrewed, which are designed to orbit bout the Earth or another celestial body or be placed into a trajectory to another celestial body or location in space, satellites, space-analog ground facilities NASA Life Sciences Portal Spacecraft/Location spacecraft spacecraft or location Provides general spatial information on the environment of the mission's activities. This includes vehicle namess, crewed or uncrewed, which are designed to orbit bout the Earth or another celestial body or be placed into a trajectory to another celestial body or location in space, satellites, space-analog ground facilities https://github.com/nasa/LSDAO An organism that is bred to have some uniform behavioral, morphological, physiological, or genetic characteristics with similarly bred organisms NASA Life Sciences Portal strain Strain strain strain An organism that is bred to have some uniform behavioral, morphological, physiological, or genetic characteristics with similarly bred organisms ?http://purl.obolibrary.org/obo/OBI_0001185 Duty center of the NASA representative NASA Life Sciences Portal center center center Radio Frequency Identification (RFID) NASA Life Sciences Portal animal id RFID animal id Radio Frequency Identification (RFID) https://github.com/nasa/LSDAO NASA Life Sciences Portal group id group id NASA Life Sciences Portal supplier id supplier id The vendor of the animals. (eg. Jackson Laboratory, Charles River Laboratories). Or supplier of the plant/ cells. NASA Life Sciences Portal supplier name Subject supplier supplier name The vendor of the animals. (eg. Jackson Laboratory, Charles River Laboratories). Or supplier of the plant/ cells. https://github.com/nasa/LSDAO A description of the subjects that were studied within the experiment NASA Life Sciences Portal subject description Subject description subject description A description of the subjects that were studied within the experiment https://github.com/nasa/LSDAO Animal body weight at launch. Unit is a separate field. cf. This is a literal value, See pato:0000128 for quality class NASA Life Sciences Portal weight Body weight at launch weight weight Animal body weight at launch. Unit is a separate field. cf. This is a literal value, See pato:0000128 for quality class https://github.com/nasa/LSDAO NASA Life Sciences Portal subject index subject_index subject index NASA Life Sciences Portal ARC-SLIMS system name Indicates the center that is coordinating the implementation of the study. Managing NASA Center managing NASA center managing_nasa_center managing NASA center Indicates the center that is coordinating the implementation of the study. https://github.com/nasa/LSDAO The additional name associated with the object additional name The date of marriage, or equivalent, of the object anniversary To specify the birth date of the object birth date The category information about the object, also known as tags category This data property has been deprecated class true The country name associated with the address of the object country name This data property has been deprecated extended address true The family name associated with the object family name The formatted text corresponding to the name of the object formatted name The given name associated with the object given name The honorific prefix of the name associated with the object honorific prefix The honorific suffix of the name associated with the object honorific suffix This data property has been deprecated label true To specify the language that may be used for contacting the object. May also be used as a property parameter. language This data property has been deprecated. See hasGeo latitude true The locality (e.g. city or town) associated with the address of the object locality This data property has been deprecated. See hasGeo longitude true This data property has been deprecated mailer true The nick name associated with the object nickname A note associated with the object note To specify the organizational name associated with the object organization name To specify the organizational unit name associated with the object organizational unit name This data property has been deprecated post office box true The postal code associated with the address of the object postal code To specify the identifier for the product that created the object product id The region (e.g. state or province) associated with the address of the object region To specify revision information about the object revision To specify the function or part played in a particular situation by the object role To specify the string to be used for national-language-specific sorting. Used as a property parameter only. sort as The street address associated with the address of the object street address To specify the position or job of the object title To indicate time zone information that is specific to the object. May also be used as a property parameter. time zone Used to indicate the literal value of a data property that requires property parameters value bounding box bounding box cuadro delimitador ohraničení oblasti quadro di delimitazione New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab tilføjet i DCAT 2.0. Propiedad nueva agregada en DCAT 2.0. Den geografiske omskrevne firkant af en ressource. El cuadro delimitador geográfico para un recurso. Il riquadro di delimitazione geografica di una risorsa. Ohraničení geografické oblasti zdroje. The geographic bounding box of a resource. El rango de esta propiedad es intencionalmente genérico con el propósito de permitir distintas codificaciones geométricas. Por ejemplo, la geometría puede ser codificada como WKT (geosparql:wktLiteral [GeoSPARQL]) o [GML] (geosparql:asGML [GeoSPARQL]). Il range di questa proprietà è volutamente generica, con lo scopo di consentire diverse codifiche geometriche. Ad esempio, la geometria potrebbe essere codificata con WKT (geosparql:wktLiteral [GeoSPARQL]) o [GML] (geosparql:asGML [GeoSPARQL]). Obor hodnot této vlastnosti je úmyslně obecný, aby umožnil různé kódování geometrií. Geometrie by kupříkladu mohla být kódována jako WKT (geosparql:wktLiteral [GeoSPARQL]) či [GML] (geosparql:asGML [GeoSPARQL]). Rækkevidden for denne egenskab er bevidst generisk defineret med det formål at tillade forskellige kodninger af geometrier. Geometrien kan eksempelvis repræsenteres som WKT (geosparql:asWKT [GeoSPARQL]) eller [GML] (geosparql:asGML [GeoSPARQL]). The range of this property is intentionally generic, with the purpose of allowing different geometry encodings. E.g., the geometry could be encoded with as WKT (geosparql:wktLiteral [GeoSPARQL]) or [GML] (geosparql:asGML [GeoSPARQL]). El tamaño de una distribución en bytes. La dimensione di una distribuzione in byte. La taille de la distribution en octects Størrelsen af en distributionen angivet i bytes. The size of a distribution in bytes. Velikost distribuce v bajtech. Το μέγεθος μιας διανομής σε bytes. الحجم بالبايتات バイトによる配信のサイズ。 byte size bytestørrelse dimensione in byte taille en octects tamaño en bytes velikost v bajtech μέγεθος σε bytes الحجم بالبايت バイト・サイズ El tamaño de una distribución en bytes. La dimensione di una distribuzione in byte. La taille de la distribution en octects. Størrelsen af en distribution angivet i bytes. The size of a distribution in bytes. Velikost distribuce v bajtech. Το μέγεθος μιας διανομής σε bytes. الحجم بالبايتات バイトによる配信のサイズ。 Bytestørrelsen kan approximeres hvis den præcise størrelse ikke er kendt. Værdien af dcat:byteSize bør angives som xsd:decimal. El tamaño en bytes puede ser aproximado cuando se desconoce el tamaño exacto. El valor literal de dcat:byteSize debe tener tipo 'xsd:decimal'. La dimensione in byte può essere approssimata quando non si conosce la dimensione precisa. Il valore di dcat:byteSize dovrebbe essere espresso come un xsd:decimal. La taille en octects peut être approximative lorsque l'on ignore la taille réelle. La valeur littérale de dcat:byteSize doit être de type xsd:decimal. The size in bytes can be approximated when the precise size is not known. The literal value of dcat:byteSize should by typed as xsd:decimal. Velikost v bajtech může být přibližná, pokud její přesná hodnota není známa. Literál s hodnotou dcat:byteSize by měl mít datový typ xsd:decimal. Το μέγεθος σε bytes μπορεί να προσεγγιστεί όταν η ακριβής τιμή δεν είναι γνωστή. Η τιμή της dcat:byteSize θα πρέπει να δίνεται με τύπο δεδομένων xsd:decimal. الحجم يمكن أن يكون تقريبي إذا كان الحجم الدقيق غير معروف 正確なサイズが不明である場合、サイズは、バイトによる近似値を示すことができます。 centroid centroid centroide centroide geometrisk tyngdepunkt centroide New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab tilføjet i DCAT 2.0. Det geometrisk tyngdepunkt (centroid) for en ressource. El centro geográfico (centroide) de un recurso. Geografický střed (centroid) zdroje. Il centro geografico (centroide) di una risorsa. The geographic center (centroid) of a resource. El rango de esta propiedad es intencionalmente genérico con el objetivo de permitir distintas codificaciones geométricas. Por ejemplo, la geometría puede codificarse como WKT (geosparql:wktLiteral [GeoSPARQL]) o [GML] (geosparql:asGML [GeoSPARQL]). Il range di questa proprietà è volutamente generica, con lo scopo di consentire diverse codifiche geometriche. Ad esempio, la geometria potrebbe essere codificata con WKT (geosparql:wktLiteral [GeoSPARQL]) o [GML] (geosparql:asGML [GeoSPARQL]). Obor hodnot této vlastnosti je úmyslně obecný, aby umožnil různé kódování geometrií. Geometrie by kupříkladu mohla být kódována jako WKT (geosparql:wktLiteral [GeoSPARQL]) či [GML] (geosparql:asGML [GeoSPARQL]). Rækkevidden for denne egenskab er bevidst generisk definere med det formål at tillade forskellige geokodninger. Geometrien kan eksempelvis repræsenteres som WKT (geosparql:asWKT [GeoSPARQL]) eller [GML] (geosparql:asGML [GeoSPARQL]). The range of this property is intentionally generic, with the purpose of allowing different geometry encodings. E.g., the geometry could be encoded with as WKT (geosparql:wktLiteral [GeoSPARQL]) or [GML] (geosparql:asGML [GeoSPARQL]). data di fine datum konce end date fecha final slutdato sluttidspunkt New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab i DCAT 2.0. El fin del período. Konec doby trvání. La fine del periodo. Slutningen på perioden. The end of the period. El rango de esta propiedad es intencionalmente genérico con el propósito de permitir distintos niveles de precisión temporal para especificar el fin del período. Por ejemplo, puede expresarse como una fecha (xsd:date), una fecha y un tiempo (xsd:dateTime), o un año (xsd:gYear). La range di questa proprietà è volutamente generico, con lo scopo di consentire diversi livelli di precisione temporale per specificare la fine di un periodo. Ad esempio, può essere espresso con una data (xsd:date), una data e un'ora (xsd:dateTime), o un anno (xsd:gYear). Obor hodnot této vlastnosti je úmyslně obecný, aby umožnil různé úrovně časového rozlišení pro specifikaci konce doby trvání. Ten může být kupříkladu vyjádřen datumem (xsd:date), datumem a časem (xsd:dateTime) či rokem (xsd:gYear). Rækkeviden for denne egenskab er bevidst generisk defineret med det formål at tillade forskellige niveauer af tidslig præcision ifm. angivelse af slutdatoen for en periode. Den kan eksempelvis udtrykkes som en dato (xsd:date), en dato og et tidspunkt (xsd:dateTime), eller et årstal (xsd:gYear). The range of this property is intentionally generic, with the purpose of allowing different level of temporal precision for specifying the end of a period. E.g., it can be expressed with a date (xsd:date), a date and time (xsd:dateTime), or a year (xsd:gYear). A keyword or tag describing a resource. Et nøgleord eller tag til beskrivelse af en ressource. Klíčové slovo nebo značka popisující zdroj. Un mot-clé ou étiquette décrivant une ressource. Una palabra clave o etiqueta que describe un recurso. Una parola chiave o un'etichetta per descrivere la risorsa. Μία λέξη-κλειδί ή μία ετικέτα που περιγράφει το σύνολο δεδομένων. كلمة مفتاحيه توصف قائمة البيانات データセットを記述しているキーワードまたはタグ。 keyword klíčové slovo mot-clés nøgleord palabra clave parola chiave λέξη-κλειδί كلمة مفتاحية キーワード/タグ A keyword or tag describing a resource. Et nøgleord eller tag til beskrivelse af en ressource. Klíčové slovo nebo značka popisující zdroj. Un mot-clé ou étiquette décrivant une ressource. Una palabra clave o etiqueta que describe un recurso. Una parola chiave o un'etichetta per descrivere la risorsa. Μία λέξη-κλειδί ή μία ετικέτα που περιγράφει το σύνολο δεδομένων. كلمة مفتاحيه توصف قائمة البيانات データセットを記述しているキーワードまたはタグ。 mindste geografiske afstand som kan erkendes i et datasæt, målt i meter. minimum spatial separation resolvable in a dataset, measured in meters. minimum spatial separation resolvable in a dataset, measured in metres. minimální prostorový rozestup rozeznatelný v datové sadě, měřeno v metrech. mínima separacíon espacial disponible en un conjunto de datos, medida en metros. separazione spaziale minima risolvibile in un set di dati, misurata in metri. geografisk opløsning (meter) prostorové rozlišení (metry) resolución espacial (metros) risoluzione spaziale (metros) spatial resolution (meters) spatial resolution (metres) New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad añadida en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny genskab tilføjet i DCAT 2.0. mindste geografiske afstand som kan resolveres i et datasæt, målt i meter. minimum spatial separation resolvable in a dataset, measured in meters. minimum spatial separation resolvable in a dataset, measured in metres. minimální prostorový rozestup rozeznatelný v datové sadě, měřeno v metrech. mínima separacíon espacial disponible en un conjunto de datos, medida en metros. separazione spaziale minima risolvibile in un set di dati, misurata in metri. Kan optræde i forbindelse med beskrivelse af datasættet eller datasætditributionen, så der er ikke angivet et domæne for egenskaben. Might appear in the description of a Dataset or a Distribution, so no domain is specified. Může se vyskytnout v popisu Datové sady nebo Distribuce, takže nebyl specifikován definiční obor. Alternative geografiske opløsninger kan leveres som forskellige datasætdistributioner. Alternative spatial resolutions might be provided as different dataset distributions. Distintas distribuciones de un conjunto de datos pueden tener resoluciones espaciales diferentes. Hvis datasættet udgøres af et billede eller et grid, så bør dette svare til afstanden mellem elementerne. For andre typer af spatiale datasæt, vil denne egenskab typisk indikere den mindste afstand mellem elementerne i datasættet. If the dataset is an image or grid this should correspond to the spacing of items. For other kinds of spatial dataset, this property will usually indicate the smallest distance between items in the dataset. Pokud je datová sada obraz či mřížka, měla by tato vlastnost odpovídat rozestupu položek. Pro ostatní druhy prostorových datových sad bude tato vlastnost obvykle indikovat nejmenší vzdálenost mezi položkami této datové sady. Risoluzioni spaziali alternative possono essere fornite come diverse distribuzioni di set di dati. Různá prostorová rozlišení mohou být poskytována jako různé distribuce datové sady. Se il set di dati è un'immagine o una griglia, questo dovrebbe corrispondere alla spaziatura degli elementi. Per altri tipi di set di dati spaziali, questa proprietà di solito indica la distanza minima tra gli elementi nel set di dati. Si el conjunto de datos es una imágen o grilla, esta propiedad corresponde al espaciado de los elementos. Para otro tipo de conjunto de datos espaciales, esta propieda usualmente indica la menor distancia entre los elementos de dichos datos. data di inizio datum začátku start date startdato starttidspunkt New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad agregada en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. Ny egenskab tilføjet i DCAT 2.0. El comienzo del período L'inizio del periodo Start på perioden. The start of the period Začátek doby trvání El rango de esta propiedad es intencionalmente genérico con el propósito de permitir distintos niveles de precisión temporal para especificar el comienzo de un período. Por ejemplo, puede expresarse como una fecha (xsd:date), una fecha y un tiempo (xsd:dateTime), o un año (xsd:gYear). Il range di questa proprietà è volutamente generico, con lo scopo di consentire diversi livelli di precisione temporale per specificare l'inizio di un periodo. Ad esempio, può essere espresso con una data (xsd:date), una data e un'ora (xsd:dateTime), o un anno (xsd:gYear). Obor hodnot této vlastnosti je úmyslně obecný, aby umožnil různé úrovně časového rozlišení pro specifikaci začátku doby trvání. Ten může být kupříkladu vyjádřen datumem (xsd:date), datumem a časem (xsd:dateTime) či rokem (xsd:gYear). Rækkeviden for denne egenskab er bevidst generisk defineret med det formål at tillade forskellige niveauer af tidslig præcision ifm. angivelse af startdatoen for en periode. Den kan eksempelvis udtrykkes som en dato (xsd:date), en dato og et tidspunkt (xsd:dateTime), eller et årstal (xsd:gYear). The range of this property is intentionally generic, with the purpose of allowing different level of temporal precision for specifying the start of a period. E.g., it can be expressed with a date (xsd:date), a date and time (xsd:dateTime), or a year (xsd:gYear). mindste tidsperiode der kan resolveres i datasættet. minimum time period resolvable in a dataset. minimální doba trvání rozlišitelná v datové sadě. periodo di tempo minimo risolvibile in un set di dati. período de tiempo mínimo en el conjunto de datos. resolución temporal risoluzione temporale temporal resolution tidslig opløsning časové rozlišení New property added in DCAT 2.0. Nová vlastnost přidaná ve verzi DCAT 2.0. Nueva propiedad añadida en DCAT 2.0. Nuova proprietà aggiunta in DCAT 2.0. mindste tidsperiode der kan resolveres i datasættet. minimum time period resolvable in a dataset. minimální doba trvání rozlišitelná v datové sadě. periodo di tempo minimo risolvibile in un set di dati. período de tiempo mínimo en el conjunto de datos. Kan optræde i forbindelse med beskrivelse af datasættet eller datasætditributionen, så der er ikke angivet et domæne for egenskaben. Might appear in the description of a Dataset or a Distribution, so no domain is specified. Může se vyskytnout v popisu Datové sady nebo Distribuce, takže nebyl specifikován definiční obor. Alternative temporal resolutions might be provided as different dataset distributions. Alternative tidslige opløsninger kan leveres som forskellige datasætdistributioner. Distintas distribuciones del conjunto de datos pueden tener resoluciones temporales diferentes. Hvis datasættet er en tidsserie, så bør denne egenskab svare til afstanden mellem elementerne i tidsserien. For andre typer af datasæt indikerer denne egenskab den mindste tidsforskel mellem elementer i datasættet. If the dataset is a time-series this should correspond to the spacing of items in the series. For other kinds of dataset, this property will usually indicate the smallest time difference between items in the dataset. Pokud je datová sada časovou řadou, měla by tato vlastnost odpovídat rozestupu položek v řadě. Pro ostatní druhy datových sad bude tato vlastnost obvykle indikovat nejmenší časovou vzdálenost mezi položkami této datové sady. Risoluzioni temporali alternative potrebbero essere fornite come diverse distribuzioni di set di dati. Různá časová rozlišení mohou být poskytována jako různé distribuce datové sady. Se il set di dati è una serie temporale, questo dovrebbe corrispondere alla spaziatura degli elementi della serie. Per altri tipi di set di dati, questa proprietà di solito indica la più piccola differenza di tempo tra gli elementi nel set di dati. Si el conjunto de datos es una serie temporal, debe corresponder al espaciado de los elementos de la serie. Para otro tipo de conjuntos de datos, esta propiedad indicará usualmente la menor diferencia de tiempo entre elementos en el dataset. A planned process that has specified output a software product and that involves the creation of source code. Mathias Brochhausen William R. Hogan http://en.wikipedia.org/wiki/Software_development A planned process resulting in a software product involving the creation of source code. software development creating a data set A planned process that has a data set as its specified output. William R. Hogan data set creation dataset creation dataset creating entity Entity Julius Caesar Verdi’s Requiem the Second World War your body mass index BFO 2 Reference: In all areas of empirical inquiry we encounter general terms of two sorts. First are general terms which refer to universals or types:animaltuberculosissurgical procedurediseaseSecond, are general terms used to refer to groups of entities which instantiate a given universal but do not correspond to the extension of any subuniversal of that universal because there is nothing intrinsic to the entities in question by virtue of which they – and only they – are counted as belonging to the given group. Examples are: animal purchased by the Emperortuberculosis diagnosed on a Wednesdaysurgical procedure performed on a patient from Stockholmperson identified as candidate for clinical trial #2056-555person who is signatory of Form 656-PPVpainting by Leonardo da VinciSuch terms, which represent what are called ‘specializations’ in [81 Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001]) entity Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf per discussion with Barry Smith An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001]) continuant Continuant continuant An entity that exists in full at any time in which it exists at all, persists through time while maintaining its identity and has no temporal parts. BFO 2 Reference: Continuant entities are entities which can be sliced to yield parts only along the spatial dimension, yielding for example the parts of your table which we call its legs, its top, its nails. ‘My desk stretches from the window to the door. It has spatial parts, and can be sliced (in space) in two. With respect to time, however, a thing is a continuant.’ [60, p. 240 Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002]) if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001]) if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002]) if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002]) (forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] (forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] (forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] (forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] (forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] (forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] (forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] (forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] continuant continuant Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002]) if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001]) if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002]) if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002]) (forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] (forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] (forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] (forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] (forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] (forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] (forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] (forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] occurrent Occurrent An entity that has temporal parts and that happens, unfolds or develops through time. BFO 2 Reference: every occurrent that is not a temporal or spatiotemporal region is s-dependent on some independent continuant that is not a spatial region BFO 2 Reference: s-dependence obtains between every process and its participants in the sense that, as a matter of necessity, this process could not have existed unless these or those participants existed also. A process may have a succession of participants at different phases of its unfolding. Thus there may be different players on the field at different times during the course of a football game; but the process which is the entire game s-depends_on all of these players nonetheless. Some temporal parts of this process will s-depend_on on only some of the players. Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process. Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame. An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002]) Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001]) b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001]) (forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] (forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] (forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] (forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] occurrent occurrent Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process. per discussion with Barry Smith Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame. An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002]) Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001]) b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001]) (forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] (forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] (forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] (forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] ic IndependentContinuant a chair a heart a leg a molecule a spatial region an atom an orchestra. an organism the bottom right portion of a human torso the interior of your mouth A continuant that is a bearer of quality and realizable entity entities, in which other entities inhere and which itself cannot inhere in anything. b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002]) For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001]) For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002]) (forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] (forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] (forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] (forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] (iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] (iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] A continuant that is a bearer of quality and realizable entity entities, in which other entities inhere and which itself cannot inhere in anything. independent continuant independent continuant b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002]) For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001]) For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002]) (forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] (forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] (forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] (forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] (iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] (iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] process Process a process of cell-division, \ a beating of the heart a process of meiosis a process of sleeping the course of a disease the flight of a bird the life of an organism your process of aging. An occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003]) BFO 2 Reference: The realm of occurrents is less pervasively marked by the presence of natural units than is the case in the realm of independent continuants. Thus there is here no counterpart of ‘object’. In BFO 1.0 ‘process’ served as such a counterpart. In BFO 2.0 ‘process’ is, rather, the occurrent counterpart of ‘material entity’. Those natural – as contrasted with engineered, which here means: deliberately executed – units which do exist in the realm of occurrents are typically either parasitic on the existence of natural units on the continuant side, or they are fiat in nature. Thus we can count lives; we can count football games; we can count chemical reactions performed in experiments or in chemical manufacturing. We cannot count the processes taking place, for instance, in an episode of insect mating behavior.Even where natural units are identifiable, for example cycles in a cyclical process such as the beating of a heart or an organism’s sleep/wake cycle, the processes in question form a sequence with no discontinuities (temporal gaps) of the sort that we find for instance where billiard balls or zebrafish or planets are separated by clear spatial gaps. Lives of organisms are process units, but they too unfold in a continuous series from other, prior processes such as fertilization, and they unfold in turn in continuous series of post-life processes such as post-mortem decay. Clear examples of boundaries of processes are almost always of the fiat sort (midnight, a time of death as declared in an operating theater or on a death certificate, the initiation of a state of war) (iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] (iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] source BFO:0000015 An occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. process process p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003]) (iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] (iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] disposition Disposition an atom of element X has the disposition to decay to an atom of element Y certain people have a predisposition to colon cancer children are innately disposed to categorize objects in certain ways. the cell wall is disposed to filter chemicals in endocytosis and exocytosis BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type. b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002]) If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002]) (forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] (forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] (forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] (forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] disposition b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002]) If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002]) (forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] (forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] (forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] (forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] realizable RealizableEntity the disposition of this piece of metal to conduct electricity. the disposition of your blood to coagulate the function of your reproductive organs the role of being a doctor the role of this boundary to delineate where Utah and Colorado meet A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances. To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002]) All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002]) (forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] (forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] (forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] (forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] realizable realizable entity To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002]) All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002]) (forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] (forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] (forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] (forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] quality Quality quality the ambient temperature of this portion of air the color of a tomato the length of the circumference of your waist the mass of this piece of gold. the shape of your nose the shape of your nostril a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001]) If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001]) (forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] (forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] quality quality a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001]) If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001]) (forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] (forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] sdc SpecificallyDependentContinuant specifically dependent continuant Reciprocal specifically dependent continuants: the function of this key to open this lock and the mutually dependent disposition of this lock: to be opened by this key of one-sided specifically dependent continuants: the mass of this tomato of relational dependent continuants (multiple bearers): John’s love for Mary, the ownership relation between John and this statue, the relation of authority between John and his subordinates. the disposition of this fish to decay the function of this heart: to pump blood the mutual dependence of proton donors and acceptors in chemical reactions [79 the mutual dependence of the role predator and the role prey as played by two organisms in a given interaction the pink color of a medium rare piece of grilled filet mignon at its center the role of being a doctor the shape of this hole. the smell of this portion of mozzarella A continuant that inheres in or is borne by other entities. Every instance of A requires some specific instance of B which must always be the same. b is a relational specifically dependent continuant = Def. b is a specifically dependent continuant and there are n &gt; 1 independent continuants c1, … cn which are not spatial regions are such that for all 1 i &lt; j n, ci and cj share no common parts, are such that for each 1 i n, b s-depends_on ci at every time t during the course of b’s existence (axiom label in BFO2 Reference: [131-004]) b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003]) Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc. (iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] (iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] (iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] (iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] A continuant that inheres in or is borne by other entities. Every instance of A requires some specific instance of B which must always be the same. characteristic specifically dependent continuant specifically dependent continuant https://github.com/OBOFoundry/COB/issues/65 https://github.com/oborel/obo-relations/pull/284 b is a relational specifically dependent continuant = Def. b is a specifically dependent continuant and there are n &gt; 1 independent continuants c1, … cn which are not spatial regions are such that for all 1 i &lt; j n, ci and cj share no common parts, are such that for each 1 i n, b s-depends_on ci at every time t during the course of b’s existence (axiom label in BFO2 Reference: [131-004]) b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003]) Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc. per discussion with Barry Smith (iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] (iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] (iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] (iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] role Role John’s role of husband to Mary is dependent on Mary’s role of wife to John, and both are dependent on the object aggregate comprising John and Mary as member parts joined together through the relational quality of being married. the priest role the role of a boundary to demarcate two neighboring administrative territories the role of a building in serving as a military target the role of a stone in marking a property boundary the role of subject in a clinical trial the student role A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts. BFO 2 Reference: One major family of examples of non-rigid universals involves roles, and ontologies developed for corresponding administrative purposes may consist entirely of representatives of entities of this sort. Thus ‘professor’, defined as follows,b instance_of professor at t =Def. there is some c, c instance_of professor role & c inheres_in b at t.denotes a non-rigid universal and so also do ‘nurse’, ‘student’, ‘colonel’, ‘taxpayer’, and so forth. (These terms are all, in the jargon of philosophy, phase sortals.) By using role terms in definitions, we can create a BFO conformant treatment of such entities drawing on the fact that, while an instance of professor may be simultaneously an instance of trade union member, no instance of the type professor role is also (at any time) an instance of the type trade union member role (any more than any instance of the type color is at any time an instance of the type length).If an ontology of employment positions should be defined in terms of roles following the above pattern, this enables the ontology to do justice to the fact that individuals instantiate the corresponding universals – professor, sergeant, nurse – only during certain phases in their lives. b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001]) (forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] (forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] role b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001]) (forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] (forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] object-aggregate ObjectAggregate a collection of cells in a blood biobank. a swarm of bees is an aggregate of members who are linked together through natural bonds a symphony orchestra an organization is an aggregate whose member parts have roles of specific types (for example in a jazz band, a chess club, a football team) defined by fiat: the aggregate of members of an organization defined through physical attachment: the aggregate of atoms in a lump of granite defined through physical containment: the aggregate of molecules of carbon dioxide in a sealed container defined via attributive delimitations such as: the patients in this hospital the aggregate of bearings in a constant velocity axle joint the aggregate of blood cells in your body the nitrogen atoms in the atmosphere the restaurants in Palo Alto your collection of Meissen ceramic plates. An entity a is an object aggregate if and only if there is a mutually exhaustive and pairwise disjoint partition of a into objects BFO 2 Reference: object aggregates may gain and lose parts while remaining numerically identical (one and the same individual) over time. This holds both for aggregates whose membership is determined naturally (the aggregate of cells in your body) and aggregates determined by fiat (a baseball team, a congressional committee). ISBN:978-3-938793-98-5pp124-158#Thomas Bittner and Barry Smith, 'A Theory of Granular Partitions', in K. Munn and B. Smith (eds.), Applied Ontology: An Introduction, Frankfurt/Lancaster: ontos, 2008, 125-158. b is an object aggregate means: b is a material entity consisting exactly of a plurality of objects as member_parts at all times at which b exists. (axiom label in BFO2 Reference: [025-004]) (forall (x) (if (ObjectAggregate x) (and (MaterialEntity x) (forall (t) (if (existsAt x t) (exists (y z) (and (Object y) (Object z) (memberPartOfAt y x t) (memberPartOfAt z x t) (not (= y z)))))) (not (exists (w t_1) (and (memberPartOfAt w x t_1) (not (Object w)))))))) // axiom label in BFO2 CLIF: [025-004] object aggregate An entity a is an object aggregate if and only if there is a mutually exhaustive and pairwise disjoint partition of a into objects An entity a is an object aggregate if and only if there is a mutually exhaustive and pairwise disjoint partition of a into objects ISBN:978-3-938793-98-5pp124-158#Thomas Bittner and Barry Smith, 'A Theory of Granular Partitions', in K. Munn and B. Smith (eds.), Applied Ontology: An Introduction, Frankfurt/Lancaster: ontos, 2008, 125-158. b is an object aggregate means: b is a material entity consisting exactly of a plurality of objects as member_parts at all times at which b exists. (axiom label in BFO2 Reference: [025-004]) (forall (x) (if (ObjectAggregate x) (and (MaterialEntity x) (forall (t) (if (existsAt x t) (exists (y z) (and (Object y) (Object z) (memberPartOfAt y x t) (memberPartOfAt z x t) (not (= y z)))))) (not (exists (w t_1) (and (memberPartOfAt w x t_1) (not (Object w)))))))) // axiom label in BFO2 CLIF: [025-004] gdc GenericallyDependentContinuant The entries in your database are patterns instantiated as quality instances in your hard drive. The database itself is an aggregate of such patterns. When you create the database you create a particular instance of the generically dependent continuant type database. Each entry in the database is an instance of the generically dependent continuant type IAO: information content entity. the pdf file on your laptop, the pdf file that is a copy thereof on my laptop the sequence of this protein molecule; the sequence that is a copy thereof in that protein molecule. A continuant that is dependent on one or other independent continuant bearers. For every instance of A requires some instance of (an independent continuant type) B but which instance of B serves can change from time to time. b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001]) (iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] (iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] generically dependent continuant generically dependent continuant b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001]) (iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] (iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] function Function the function of a hammer to drive in nails the function of a heart pacemaker to regulate the beating of a heart through electricity the function of amylase in saliva to break down starch into sugar BFO 2 Reference: In the past, we have distinguished two varieties of function, artifactual function and biological function. These are not asserted subtypes of BFO:function however, since the same function – for example: to pump, to transport – can exist both in artifacts and in biological entities. The asserted subtypes of function that would be needed in order to yield a separate monoheirarchy are not artifactual function, biological function, etc., but rather transporting function, pumping function, etc. A function is a disposition that exists in virtue of the bearer’s physical make-up and this physical make-up is something the bearer possesses because it came into being, either through evolution (in the case of natural biological entities) or through intentional design (in the case of artifacts), in order to realize processes of a certain sort. (axiom label in BFO2 Reference: [064-001]) (forall (x) (if (Function x) (Disposition x))) // axiom label in BFO2 CLIF: [064-001] (forall (x) (if (Function x) (Disposition x))) // axiom label in BFO2 CLIF: [064-001] function A function is a disposition that exists in virtue of the bearer’s physical make-up and this physical make-up is something the bearer possesses because it came into being, either through evolution (in the case of natural biological entities) or through intentional design (in the case of artifacts), in order to realize processes of a certain sort. (axiom label in BFO2 Reference: [064-001]) (forall (x) (if (Function x) (Disposition x))) // axiom label in BFO2 CLIF: [064-001] (forall (x) (if (Function x) (Disposition x))) // axiom label in BFO2 CLIF: [064-001] material MaterialEntity material entity material entity Collection of random bacteria, a chair, dorsal surface of the body. a flame a forest fire a human being a hurricane a photon a puff of smoke a sea wave a tornado an aggregate of human beings. an energy wave an epidemic the undetached arm of a human being An independent continuant [snap:IndependentContinuant] that is spatially extended whose identity is independent of that of other entities and can be maintained through time. Note: Material entity [snap:MaterialEntity] subsumes object [snap:Object], fiat object part [snap:FiatObjectPart], and object aggregate [snap:ObjectAggregate], which assume a three level theory of granularity, which is inadequate for some domains, such as biology. An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time. BFO 2 Reference: Material entities (continuants) can preserve their identity even while gaining and losing material parts. Continuants are contrasted with occurrents, which unfold themselves in successive temporal parts or phases [60 BFO 2 Reference: Object, Fiat Object Part and Object Aggregate are not intended to be exhaustive of Material Entity. Users are invited to propose new subcategories of Material Entity. BFO 2 Reference: ‘Matter’ is intended to encompass both mass and energy (we will address the ontological treatment of portions of energy in a later version of BFO). A portion of matter is anything that includes elementary particles among its proper or improper parts: quarks and leptons, including electrons, as the smallest particles thus far discovered; baryons (including protons and neutrons) at a higher level of granularity; atoms and molecules at still higher levels, forming the cells, organs, organisms and other material entities studied by biologists, the portions of rock studied by geologists, the fossils studied by paleontologists, and so on.Material entities are three-dimensional entities (entities extended in three spatial dimensions), as contrasted with the processes in which they participate, which are four-dimensional entities (entities extended also along the dimension of time).According to the FMA, material entities may have immaterial entities as parts – including the entities identified below as sites; for example the interior (or ‘lumen’) of your small intestine is a part of your body. BFO 2.0 embodies a decision to follow the FMA here. BFO A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002]) Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002]) every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002]) (forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] (forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] material entity material entity A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002]) Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002]) every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002]) (forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] (forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] An agent, stimulus, activity, or event that causes stress or tension on an organism and interacts with an exposure_receptor during an exposure event. 2010-09-21T02:43:50Z exposure_stressor ExO:0000000 exposure stressor An agent, stimulus, activity, or event that causes stress or tension on an organism and interacts with an exposure_receptor during an exposure event. CTD:curators An entity (e.g., a human, human population, or a human organ) that interacts with an exposure stressor during an exposure event. cmattin 2010-09-21T02:45:36Z exposure recipient exposure target exposure_receptor ExO:0000001 exposure_receptor An entity (e.g., a human, human population, or a human organ) that interacts with an exposure stressor during an exposure event. CTD:curators An interaction between an exposure stressor and an exposure_receptor. cmattin 2010-09-21T02:47:00Z exposure_event ExO:0000002 exposure event An interaction between an exposure stressor and an exposure_receptor. CTD:curators The earth, all of the organisms living on it, and all of the environmental factors, which act on the organisms. The volume of area where biological matter can exist, slightly above, on or below ground level. cmattin 2011-01-10T09:26:27Z exposure_receptor ExO:0000030 ecosphere The earth, all of the organisms living on it, and all of the environmental factors, which act on the organisms. The volume of area where biological matter can exist, slightly above, on or below ground level. XCTD:curators MERGED DEFINITION:\nTARGET DEFINITION: An exposure_receptor that is the global ecological system integrating all living beings and their relationships, including their interaction with the elements of the lithosphere, hydrosphere and atmosphere.\n--------------------\nSOURCE DEFINITION: An exposure_receptor that is the part of the environment that is made or modified by humans for use in human activities and human habitats. cmattin 2011-01-10T09:27:26Z ExO:0000032 anthrosphere exposure_receptor ExO:0000031 biosphere MERGED DEFINITION:\nTARGET DEFINITION: An exposure_receptor that is the global ecological system integrating all living beings and their relationships, including their interaction with the elements of the lithosphere, hydrosphere and atmosphere.\n--------------------\nSOURCE DEFINITION: An exposure_receptor that is the part of the environment that is made or modified by humans for use in human activities and human habitats. GOC:hjd An exposure_receptor that is a group of Homo sapiens inhabiting a given area. cmattin 2011-01-10T09:28:02Z exposure_receptor ExO:0000033 human population An exposure_receptor that is a group of Homo sapiens inhabiting a given area. CTD:curators The condition of an organism in all aspects (e.g., functional or metabolic efficiency). cmattin 2011-01-10T09:29:51Z human_attribute ExO:0000038 health status The condition of an organism in all aspects (e.g., functional or metabolic efficiency). CTD:curators Being or characteristic of a single thing or person. cmattin 2011-01-10T09:30:56Z exposure_receptor ExO:0000042 human individual Being or characteristic of a single thing or person. CTD:curators An attribute describing some aspect of an individual or human population. cmattin 2011-01-10T09:30:27Z human_attribute ExO:0000089 human attribute An attribute describing some aspect of an individual or human population. CTD:curators How long something or someone has existed; elapsed time since birth. cgrondin 2017-04-06T03:47:29Z https://ncit.nci.nih.gov/ncitbrowser/pages/concept_details.jsf?dictionary=NCI_Thesaurus&version=16.07d&code=C25150&ns=null&type=properties&key=null&b=1&n=0&vse=null human_attribute aged chronological age postnatal age ExO:0000102 age Other conditions with the power to have an effect on health status. cgrondin 2017-04-06T03:47:29Z https://ncit.nci.nih.gov/ncitbrowser/pages/concept_details.jsf?dictionary=NCI_Thesaurus&version=16.07d&code=C121660&ns=NCI_Thesaurus&type=properties&key=n821927297&b=1&n=0&vse=null health_status Influence ExO:0000103 influencing factor The assemblage of physical properties or qualities by which male is distinguished from female; the physical difference between male and female; the distinguishing peculiarity of male or female. cgrondin 2017-04-06T03:47:29Z https://ncit.nci.nih.gov/ncitbrowser/pages/concept_details.jsf?dictionary=NCI_Thesaurus&version=16.07d&code=C28421&ns=NCI_Thesaurus&type=properties&key=n1987444752&b=1&n=0&vse=null human_attribute gender ExO:0000110 sex A sequence feature (continuous extent of biological sequence) that is of genomic origin (i.e. carries sequence from the genome of a cell or organism) This class was created largely as a modeling convenience to support organizing data for schema definitions. We may consider obsoleting it if it ends up causing confusion or complicating classification of terms in the ontology. 1. A feature being 'of genomic origin' here means only that its sequence has been located to the genome of some organism by alignment with some reference genome. This is because the sequence was originally identified in, or artificially created to replicate, sequence from an organism's genome. 2. The location of a genomic feature is defined by start and end coordinates based on alignment with a reference genome. Genomic features can span any size from a complete chromosome, to a chromosomal band or region, to a gene, to a single base pair or even junction between base pairs (this would be a sequence feature with an extent of zero). 3. As sequence features, instances of genomic features are identified by both their inherent *sequence* and their *position* in a genome - as determined by an alignment with some reference sequence. Accordingly, the 'ATG' start codon in the coding DNA sequence of the human AKT gene and the 'ATG' start codon in the human SHH gene represent two distinct genomic features despite having he same sequence, in virtue of their different positions in the genome. genomic feature 1. The set of all alleles at a particular location in a genome (a 'single locus complement') - e.g. {APOE-epsilon2 / APOE-epsilon4} at the APOE locus 2. The set of all alleles that comprise a haplotype - e.g. the SNPs {rs7412-T, rs429358-T} in the APOEɛ2 allele. 3. The set of all chromosomes in a genome - e.g. {human Chr1, 2, 3, . . . 22, X, Y} A set of sequence features. 'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. Sets may also include duplicates (i.e. contain more than one member representing the same feature). The notion of a 'complement' is a special case of a set, where the members necessarily comprise an exhaustive collection of all objects that make up some well-defined set. It is useful for defining many biologically-relevant sets of sequence features. For example, a 'haplotype' is the set of all genetically-linked alleles on a single chromosomal strand at a defined location - e.g. the SNP alleles {rs7412-C, rs429358-C} comprise the haplotype defining the APOEɛ4 gene allele [1]. And a 'single locus complement' is the set of all alleles at a specified location in a particular genome - e.g. the APOEɛ4 and APOEɛ4 gene alleles ([1], [2]) that make up the 'Gs270' APOE genotype [3]. [1] https://www.snpedia.com/index.php/APOE-%CE%B54 [2] https://www.snpedia.com/index.php/APOE-%CE%B52 [3] https://www.snpedia.com/index.php/Gs270 sequence feature set A set of genomic features (i.e. sequence features that are of genomic origin). In some cases there may be zero or only one member of such a complement, which is why this class is not defened to necessarily have some 'genomic feature' as a member. genomic locus complement A genomic feature is any located sequence feature in the genome, from a single nucleotide to a gene into an entire chromosome. 'Sets' are used to represent entities that are typically collections of more than one member - e.g. the set of chromosomes that make up the human genome. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. For example, a 'single locus complement' at an X-linked locus in a XY male will consist of only one allele, as there is only one X-chromosome in the genome. Note also that sets may contain duplicates (i.e. more than one member representing the same feature). For example, a homozygous 'single locus complement' is a set comprised of two of the same feature. The notion of a 'genomic feature set' differs from that of a 'genomic sequence set' in that we are counting how many copies of the same *sequence feature* exist in a genome, as opposed to how many of the same *sequence*. 'Genomic feature sets are useful for representing things like 'single locus complements', where members are sequence features whose identity is dependent on their location. By contrast, 'genomic sequence sets' are useful for describing things like 'copy number complements', which are concerned only with how many copies of a sequence exist in a genome, regardless of the location where these reside. genomic feature set A sequence feature or a set of such features. sequence feature or collection GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location. sequence feature or set A linear ordering of units representing monomers of a biological macromolecule (e.g. nucleotides in DNA and RNA, amino acids in polypeptides). GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern). biomacromolecular sequence state VMC:State 'Sequences' differ from 'sequence features' in that instances are distinguished only by their inherent ordering of units, and not by any positional aspect related to alignment with some reference sequence. Accordingly, the 'ATG' translational start codon of the human AKT gene is the same *sequence* as the 'ATG' start codon of the human SHH gene, but these represent two distinct *sequence features* in virtue of their different positions in the genome. biological sequence true state In the VMC model, the notion of a GENO:biological sequence is called the 'state' of an allele. A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification. qualified sequence feature or collection Consider wild-type zebrafish shha gene in the context of being targeted by morpholino MO-1 vs morpholino MO-2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'qualified sequence feature' because of their different external contexts. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants (alleles) of the same gene can have potentially different associated phenotypes). A qualified sequence feature that carries sequence derived from the genome of a cell or organism. qualified genomic feature true This axiom is an initial attempt to formalize the identity criteria of an extrinnsic context that separates qualified sequence features from sequence features (i.e. the context of its material bearer). As we further develop our efforts here this will get refined and more precise. true Formalizes one identity criteria of the sequence feature component of a qualified sequence feature (which itself is identified by its sequence and its genomic position). A set of qualified sequence features that carry genomic sequence. Because there are cases there may be zero or only one member of such a set, this class is not asserted to necessarily have some 'qualified genomic feature' as a member. A 'complement' refers to an exhaustive collection of all objects that make up some well-defined set. This notion is useful for defining biologically-relevant sets of sequence features. For example, a haplotype is defined as the set of all genetically-linked alleles on a single chromosomal strand at a defined location - e.g. the SNP alleles {rs7412-C, rs429358-C} comprise the haplotype defining the APOEɛ4 gene allele. A complements may contain 0, 1, or more than one members. For example, the complement of alleles at a defined locus across homologous chromosomes in an individual's genome will consist of two members for autosomal locations, and one member for non-homologous locations on the X and Y chromosome. qualified genomic feature set The location of a sequence feature as defined by its start and end position on some reference coordinate system. 1. A sequence feature location is defined by its begin and end coordinates on a reference sequence, but it is not identified by a particular sequence that may reside there. The same location, as defined on a particular reference, may be occupied by different sequences in the genome of organism 1 vs that of organism 2 (e.g. if a SNV exists within this location in only one of the organisms). 2. The notion of a sequence feature location in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be 'occupied by' physical objects, while a genomic location is 'occupied by' sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a genomic location is distinct from a sequence feature that occupies it. As a more concrete example, consider the distinction between a street address and the building that occupies it as analogous to the relationship between a genomic locus and the sequence feature that resides there. sequence feature location true An generically dependent continuant that carries biological sequence that is part of or derived from a genome. An abstract/organizational class to support data modeling, that includes genomic features, genomic feature complements, qualified genomic features and their complements, as well as genotypes that denote such entities. genomic entity The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system In GENO, the notion of a Genomic Location (aka Genomic Locus) plays the same role as that of a FALDO:Region in the design pattern for describing the location of a feature of interest. We define this specific GENO class because the ontological nature of FALDO:Region class is not clear in the context of the BFO and SO-based GENO model. We will work to resolve these questions and ideally converge these concepts in the future. We don't link a Genomic Location to a specific reference sequence because in the FALDO model (which GENO adopts with the exception of swapping GENO:Genomic Locus for FALDO:Region), allows the start and end positions of a region to be defined on separate reference sequences. So while a given Location is conceptually associated with a single reference, in practice it can be pragmatic to define start and stop on different references sequences. In practice, GENO advocates describing biology at the level of genomic features - i.e. define specific terms for genes as genomic features, and not duplicate representation of the loci where each gene resides. So we might define a class representing the human Shh gene as a 'genomic feature', but not parallel this with a 'human Shh gene locus' class. The utility of the 'genomic locus' class in the ontology is primarily to be clear about the distinction, but we would only use it in modeling data if absolutely needed. For example, we would define an 'HLA gene block' as a subclass of 'genomic feature', and assert that HLA-A, HLA-B, and HLA-C genes are part/subsequences of this HLA gene block (as opposed to modeling this as an 'HLA locus' and asserting that the HLA-A, HLA-B, and HLA-C genes occupy this locus). genomic location genomic locus VMC:Location 1. A genomic location (aka locus) is defined by its begin and end coordinates on a reference genome, independent of a particular sequence that may reside there. In GENO, we say that a genomic location is occupied_by a 'sequence feature' - where the identity of this feature depends on both it sequence, and its location in the genome (i.e. the locus it occupies). For example, the 'ATG' sequence beginning the ORF of the human SHH gene shares the *same sequence* as the 'ATG' beginning the ORF of the human AKT gene. But these are *distinct sequence features* because they occupy different genomic locations. 2. A given genomic location (e.g. the human SHH gene locus) may be occupied by different alleles (e.g. different alleles of the SHH gene). Within the genome of a single diploid organism, there is potential for two alleles to exist at such a locus (i.e. two different versions of the SHH gene). And across genomes of all members of a species, many more alleles of the SHH gene may exist and occupy this same locus. 3. The notion of a genomic location in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be occupied_by physical objects, while a genomic location is occupied_by sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a genomic locus is distinct from a sequence feature that occupies it. As a more concrete example, consider the distinction between a street address and the building that occupies it as analogous to the relationship between a genomic location and the feature that resides there. genomic feature location true A material entity that is an organism, derived from an organism, or composed of organisms (e.g. a cell line, biosample, tissue culture, population, etc). useful organizational term to collect entities that have genomes/genotypes. organismal entity Consider wild-type zebrafish shha gene in the context of being targeted by morpholino MO-1 vs morpholino MO-2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'qualified sequence feature' because of their different external contexts. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants (alleles) of the same gene can have potentially different associated phenotypes). A sequence feature whose identity is additionally dependent on the context or state of the material sequence molecule in which the feature is concretized. This context/state describes factors external to the feature's intrinsic sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification. GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical state or context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern). Modeling sequence entities at this 'qualified' level is useful for distinguishing cases where features with identical sequence and position as separate instances - based on their material bearers being found in different contexts. For example, consider a situation where the zebrafish shha gene (a sequence feature) is targeted in two experimental groups of fish by two different morpholinos, and phenotypes are assessed for each. We want to be able to represent two 'variants' of the shha gene in this scenario as separate 'qualified sequence feature' instances so we can capture data about the phenotypes resulting from each - just as we would separately represent to different sequence variants (alleles) of the shha gene at the sequence feature level so that we can track their associated phenotypes. qualified sequence feature A set of qualified seqeunce features. 'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'matehmatical sets'. qualified sequence feature set A biolocical sequence, or set of such sequences. biological sequence or collection biological sequence or set A biological sequence that is of genomic origin (i.e. carries sequence from the genome of a cell or organism). A sequence being 'of genomic origin' here means only that it has been located to the genome of some organism by alignment with some reference genomic sequence. This is because the sequence was originally identified in, or artificially created to replicate, sequence from an organism's genome. genomic sequence A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs. molecular process molecular function GO:0003674 Note that, in addition to forming the root of the molecular function ontology, this term is recommended for use for the annotation of gene products whose molecular function is unknown. When this term is used for annotation, it indicates that no information was available about the molecular function of the gene product annotated as of the date the annotation was made; the evidence code 'no data' (ND), is used to indicate this. Despite its name, this is not a type of 'function' in the sense typically defined by upper ontologies such as Basic Formal Ontology (BFO). It is instead a BFO:process carried out by a single gene product or complex. This is the same as GO molecular function gene product or complex activity molecular_function A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs. GOC:pdt catalytic activity A biological process is the execution of a genetically-encoded biological module or program. It consists of all the steps required to achieve the specific biological objective of the module. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence. A process that emerges from two or more causally-connected macromolecular activities and has evolved to achieve a biological objective. jl 2012-09-19T15:05:24Z Wikipedia:Biological_process biological process physiological process single organism process single-organism process GO:0008150 A biological process is an evolved process Note that, in addition to forming the root of the biological process ontology, this term is recommended for use for the annotation of gene products whose biological process is unknown. When this term is used for annotation, it indicates that no information was available about the biological process of the gene product annotated as of the date the annotation was made; the evidence code 'no data' (ND), is used to indicate this. biological process biological_process A biological process is the execution of a genetically-encoded biological module or program. It consists of all the steps required to achieve the specific biological objective of the module. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence. GOC:pdt true Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. Reactome:R-HSA-6788855 Reactome:R-HSA-6788867 phosphokinase activity GO:0016301 Note that this term encompasses all activities that transfer a single phosphate group; although ATP is by far the most common phosphate donor, reactions using other phosphate donors are included in this term. kinase activity Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. ISBN:0198506732 Reactome:R-HSA-6788855 FN3KRP phosphorylates PsiAm, RibAm Reactome:R-HSA-6788867 FN3K phosphorylates ketosamines transferase activity transferase activity, transferring phosphorus-containing groups measurement unit label Examples of measurement unit labels are liters, inches, weight per volume. A measurement unit label is as a label that is part of a scalar measurement datum and denotes a unit of measure. 2009-03-16: provenance: a term measurement unit was proposed for OBI (OBI_0000176) , edited by Chris Stoeckert and Cristian Cocos, and subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definition of this, different, term. 2009-03-16: review of this term done during during the OBI workshop winter 2009 and the current definition was considered acceptable for use in OBI. If there is a need to modify this definition please notify OBI. PERSON: Alan Ruttenberg PERSON: Melanie Courtot measurement unit label objective specification In the protocol of a ChIP assay the objective specification says to identify protein and DNA interaction. A directive information entity that describes an intended process endpoint. When part of a plan specification the concretization is realized in a planned process in which the bearer tries to effect the world so that the process endpoint is achieved. 2009-03-16: original definition when imported from OBI read: "objective is an non realizable information entity which can serve as that proper part of a plan towards which the realization of the plan is directed." 2014-03-31: In the example of usage ("In the protocol of a ChIP assay the objective specification says to identify protein and DNA interaction") there is a protocol which is the ChIP assay protocol. In addition to being concretized on paper, the protocol can be concretized as a realizable entity, such as a plan that inheres in a person. The objective specification is the part that says that some protein and DNA interactions are identified. This is a specification of a process endpoint: the boundary in the process before which they are not identified and after which they are. During the realization of the plan, the goal is to get to the point of having the interactions, and participants in the realization of the plan try to do that. Answers the question, why did you do this experiment? PERSON: Alan Ruttenberg PERSON: Barry Smith PERSON: Bjoern Peters PERSON: Jennifer Fostel goal specification OBI Plan and Planned Process/Roles Branch OBI_0000217 objective specification Pour the contents of flask 1 into flask 2 A directive information entity that describes an action the bearer will take. Alan Ruttenberg OBI Plan and Planned Process branch action specification datum label A label is a symbol that is part of some other datum and is used to either partially define the denotation of that datum or to provide a means for identifying the datum as a member of the set of data with the same label http://www.golovchenko.org/cgi-bin/wnsearch?q=label#4n GROUP: IAO 9/22/11 BP: changed the rdfs:label for this class from 'label' to 'datum label' to convey that this class is not intended to cover all kinds of labels (stickers, radiolabels, etc.), and not even all kind of textual labels, but rather the kind of labels occuring in a datum. 9/22/11 BP: changed the rdfs:label for this class from 'label' to 'datum label' to convey that this class is not intended to cover all kinds of labels (stickers, radiolabels, etc.), and not even all kind of textual labels, but rather the kind of labels occuring in a datum. datum label software Software is a plan specification composed of a series of instructions that can be interpreted by or directly executed by a processing unit. see sourceforge tracker discussion at http://sourceforge.net/tracker/index.php?func=detail&aid=1958818&group_id=177891&atid=886178 PERSON: Alan Ruttenberg PERSON: Bjoern Peters PERSON: Chris Stoeckert PERSON: Melanie Courtot GROUP: OBI software information carrier In the case of a printed paperback novel the physicality of the ink and of the paper form part of the information bearer. The qualities of appearing black and having a certain pattern for the ink and appearing white for the paper form part of the information carrier in this case. A quality of an information bearer that imparts the information content 12/15/09: There is a concern that some ways that carry information may be processes rather than qualities, such as in a 'delayed wave carrier'. 2014-03-10: We are not certain that all information carriers are qualities. There was a discussion of dropping it. PERSON: Alan Ruttenberg Smith, Ceusters, Ruttenberg, 2000 years of philosophy information carrier data item Data items include counts of things, analyte concentrations, and statistical summaries. An information content entity that is intended to be a truthful statement about something (modulo, e.g., measurement precision or other systematic errors) and is constructed/acquired by a method which reliably tends to produce (approximately) truthful statements. 2/2/2009 Alan and Bjoern discussing FACS run output data. This is a data item because it is about the cell population. Each element records an event and is typically further composed a set of measurment data items that record the fluorescent intensity stimulated by one of the lasers. 2009-03-16: data item deliberatly ambiguous: we merged data set and datum to be one entity, not knowing how to define singular versus plural. So data item is more general than datum. 2009-03-16: removed datum as alternative term as datum specifically refers to singular form, and is thus not an exact synonym. 2014-03-31: See discussion at http://odontomachus.wordpress.com/2014/03/30/aboutness-objects-propositions/ JAR: datum -- well, this will be very tricky to define, but maybe some information-like stuff that might be put into a computer and that is meant, by someone, to denote and/or to be interpreted by some process... I would include lists, tables, sentences... I think I might defer to Barry, or to Brian Cantwell Smith JAR: A data item is an approximately justified approximately true approximate belief PERSON: Alan Ruttenberg PERSON: Chris Stoeckert PERSON: Jonathan Rees data data item information content entity Examples of information content entites include journal articles, data, graphical layouts, and graphs. Examples of information content entites include journal articles, data, graphical layouts, and graphs. A generically dependent continuant that is about some thing. An information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity. an information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity 2014-03-10: The use of "thing" is intended to be general enough to include universals and configurations (see https://groups.google.com/d/msg/information-ontology/GBxvYZCk1oc/-L6B5fSBBTQJ). information_content_entity 'is_encoded_in' some digital_entity in obi before split (040907). information_content_entity 'is_encoded_in' some physical_document in obi before split (040907). Previous. An information content entity is a non-realizable information entity that 'is encoded in' some digital or physical entity. PERSON: Chris Stoeckert IAO OBI_0000142 information content entity information content entity An information content entity whose concretizations indicate to their bearer how to realize them in a process. 2009-03-16: provenance: a term realizable information entity was proposed for OBI (OBI_0000337) , edited by the PlanAndPlannedProcess branch. Original definition was "is the specification of a process that can be concretized and realized by an actor" with alternative term "instruction".It has been subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definitionof this, different, term. 2013-05-30 Alan Ruttenberg: What differentiates a directive information entity from an information concretization is that it can have concretizations that are either qualities or realizable entities. The concretizations that are realizable entities are created when an individual chooses to take up the direction, i.e. has the intention to (try to) realize it. 8/6/2009 Alan Ruttenberg: Changed label from "information entity about a realizable" after discussions at ICBO Werner pushed back on calling it realizable information entity as it isn't realizable. However this name isn't right either. An example would be a recipe. The realizable entity would be a plan, but the information entity isn't about the plan, it, once concretized, *is* the plan. -Alan PERSON: Alan Ruttenberg PERSON: Bjoern Peters directive information entity dot plot Dot plot of SSC-H and FSC-H. A dot plot is a report graph which is a graphical representation of data where each data point is represented by a single dot placed on coordinates corresponding to data point values in particular dimensions. person:Allyson Lister person:Chris Stoeckert OBI_0000123 group:OBI dot plot graph A diagram that presents one or more tuples of information by mapping those tuples in to a two dimensional space in a non arbitrary way. PERSON: Lawrence Hunter person:Alan Ruttenberg person:Allyson Lister OBI_0000240 group:OBI graph algorithm PMID: 18378114.Genomics. 2008 Mar 28. LINKGEN: A new algorithm to process data in genetic linkage studies. A plan specification which describes the inputs and output of mathematical functions as well as workflow of execution for achieving an predefined objective. Algorithms are realized usually by means of implementation as computer programs for execution by automata. Philippe Rocca-Serra PlanAndPlannedProcess Branch OBI_0000270 adapted from discussion on OBI list (Matthew Pocock, Christian Cocos, Alan Ruttenberg) algorithm curation status specification The curation status of the term. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value. Better to represent curation as a process with parts and then relate labels to that process (in IAO meeting) PERSON:Bill Bug GROUP:OBI:<http://purl.obolibrary.org/obo/obi> OBI_0000266 curation status specification source code module The written source code that implements part of an algorithm. Test - if you know that it was written in a specific language, then it can be source code module. We mean here, roughly, the wording of a document such as a perl script. A source code module is a directive information entity that specifies, using a programming language, some algorithm. person:Alan Ruttenberg person:Chris Stoeckert OBI_0000039 group:OBI source code module data format specification A data format specification is the information content borne by the document published defining the specification. Example: The ISO document specifying what encompasses an XML document; The instructions in a XSD file 2009-03-16: provenance: term imported from OBI_0000187, which had original definition "A data format specification is a plan which organizes information. Example: The ISO document specifying what encompasses an XML document; The instructions in a XSD file" PERSON: Alan Ruttenberg PlanAndPlannedProcess Branch OBI branch derived OBI_0000187 data format specification data set Intensity values in a CEL file or from multiple CEL files comprise a data set (as opposed to the CEL files themselves). A data item that is an aggregate of other data items of the same type that have something in common. Averages and distributions can be determined for data sets. 2009/10/23 Alan Ruttenberg. The intention is that this term represent collections of like data. So this isn't for, e.g. the whole contents of a cel file, which includes parameters, metadata etc. This is more like java arrays of a certain rather specific type 2014-05-05: Data sets are aggregates and thus must include two or more data items. We have chosen not to add logical axioms to make this restriction. person:Allyson Lister person:Chris Stoeckert OBI_0000042 group:OBI data set image An image is an affine projection to a two dimensional surface, of measurements of some quality of an entity or entities repeated at regular intervals across a spatial range, where the measurements are represented as color and luminosity on the projected on surface. person:Alan Ruttenberg person:Allyson person:Chris Stoeckert OBI_0000030 group:OBI image data about an ontology part Data about an ontology part is a data item about a part of an ontology, for example a term Person:Alan Ruttenberg ontology metadata data about an ontology part data about an ontology part plan specification PMID: 18323827.Nat Med. 2008 Mar;14(3):226.New plan proposed to help resolve conflicting medical advice. A directive information entity with action specifications and objective specifications as parts that, when concretized, is realized in a process in which the bearer tries to achieve the objectives by taking the actions specified. A directive information entity with action specifications and objective specifications as parts, and that may be concretized as a realizable entity that, if realized, is realized in a process in which the bearer tries to achieve the objectives by taking the actions specified. 2009-03-16: provenance: a term a plan was proposed for OBI (OBI_0000344) , edited by the PlanAndPlannedProcess branch. Original definition was " a plan is a specification of a process that is realized by an actor to achieve the objective specified as part of the plan". It has been subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definitionof this, different, term. 2014-03-31: A plan specification can have other parts, such as conditional specifications. 2022-01-16 Updated definition to that proposed by Clint Dowloand, IAO Issue 231. Alternative previous definition: a plan is a set of instructions that specify how an objective should be achieved Alan Ruttenberg Clint Dowland OBI Plan and Planned Process branch OBI_0000344 2/3/2009 Comment from OBI review. Action specification not well enough specified. Conditional specification not well enough specified. Question whether all plan specifications have objective specifications. Request that IAO either clarify these or change definitions not to use them plan specification https://github.com/information-artifact-ontology/IAO/issues/231#issuecomment-1010455131 material information bearer A page of a paperback novel with writing on it. The paper itself is a material information bearer, the pattern of ink is the information carrier. a brain a hard drive A material entity in which a concretization of an information content entity inheres. GROUP: IAO material information bearer histogram A histogram is a report graph which is a statistical description of a distribution in terms of occurrence frequencies of different event classes. PERSON:Chris Stoeckert PERSON:James Malone PERSON:Melanie Courtot GROUP:OBI histogram heatmap A heatmap is a report graph which is a graphical representation of data where the values taken by a variable(s) are shown as colors in a two-dimensional map. PERSON:Chris Stoeckert PERSON:James Malone PERSON:Melanie Courtot GROUP:OBI heatmap dendrogram Dendrograms are often used in computational biology to illustrate the clustering of genes. A dendrogram is a report graph which is a tree diagram frequently used to illustrate the arrangement of the clusters produced by a clustering algorithm. PERSON:Chris Stoeckert PERSON:James Malone PERSON:Melanie Courtot WEB: http://en.wikipedia.org/wiki/Dendrogram dendrogram scatter plot Comparison of gene expression values in two samples can be displayed in a scatter plot A scatterplot is a graph which uses Cartesian coordinates to display values for two variables for a set of data. The data is displayed as a collection of points, each having the value of one variable determining the position on the horizontal axis and the value of the other variable determining the position on the vertical axis. PERSON:Chris Stoeckert PERSON:James Malone PERSON:Melanie Courtot scattergraph WEB: http://en.wikipedia.org/wiki/Scatterplot scatter plot obsolescence reason specification The reason for which a term has been deprecated. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value. The creation of this class has been inspired in part by Werner Ceusters' paper, Applying evolutionary terminology auditing to the Gene Ontology. PERSON: Alan Ruttenberg PERSON: Melanie Courtot obsolescence reason specification figure Any picture, diagram or table An information content entity consisting of a two dimensional arrangement of information content entities such that the arrangement itself is about something. PERSON: Lawrence Hunter figure diagram A molecular structure ribbon cartoon showing helices, turns and sheets and their relations to each other in space. A figure that expresses one or more propositions PERSON: Lawrence Hunter diagram document A journal article, patent application, laboratory notebook, or a book A collection of information content entities intended to be understood together as a whole PERSON: Lawrence Hunter document denotator type The Basic Formal Ontology ontology makes a distinction between Universals and defined classes, where the formal are "natural kinds" and the latter arbitrary collections of entities. A denotator type indicates how a term should be interpreted from an ontological perspective. Alan Ruttenberg Barry Smith, Werner Ceusters denotator type Recording the current temperature in a laboratory notebook. Writing a journal article. Updating a patient record in a database. A planned process in which a document is created or added to by including the specified input in it. 6/11/9: Edited at OBI workshop. We need to be able identify a child form of information artifact which corresponds to something enduring (not brain like). This used to be restricted to physical document or digital entity as the output, but that excludes e.g. an audio cassette tape Bjoern Peters wikipedia http://en.wikipedia.org/wiki/Documenting documenting Viruses Viruses Euteleostomi bony vertebrates Euteleostomi Bacteria eubacteria Bacteria Archaea Archaea Eukaryota eucaryotes eukaryotes Eukaryota Euarchontoglires Euarchontoglires Tetrapoda tetrapods Tetrapoda Amniota amniotes Amniota Opisthokonta Opisthokonta Metazoa metazoans multicellular animals Metazoa Bilateria Bilateria Mammalia mammals Mammalia Vertebrata <vertebrates> Vertebrata vertebrates Vertebrata <vertebrates> Homo sapiens human human being Homo sapiens A categorical value specification that is used to record the destruction of an organism cells or tissues by the organisms' own enzymes or processes with nominal categories ranging from none to severe. Add instances 0-non, 1-slight, 2-moderate, 3-severe Person: Chris Stoeckert, Helena Ellis, Jie Zheng OBIB NCI BBRB autolysis value specification A data item that contains the outcome of a survey. Alice Nzinga Mathias Brochhausen survey data A plan specification that is realized by process of gathering information (e.g. by asking questions). Alice Nzinga Mathias Brochhausen survey plan specification A planned process that realizes the concretization of a survey to generate an output(survey data.) survey execution A specimen that is normal. normal specimen A Homo sapiens who contributes specimen. Alice Nzinga Mathias Brochhausen sample donor specimen donor planned process planned process Injecting mice with a vaccine in order to test its efficacy A process that realizes a plan which is the concretization of a plan specification. A processual entity that realizes a plan which is the concretization of a plan specification. 'Plan' includes a future direction sense. That can be problematic if plans are changed during their execution. There are however implicit contingencies for protocols that an agent has in his mind that can be considered part of the plan, even if the agent didn't have them in mind before. Therefore, a planned process can diverge from what the agent would have said the plan was before executing it, by adjusting to problems encountered during execution (e.g. choosing another reagent with equivalent properties, if the originally planned one has run out.) Stub class to serve as root of hierarchy for experimental techniques and processes, defined in GENO or imported from ontologies such as OBI and ERO. We are only considering successfully completed planned processes. A plan may be modified, and details added during execution. For a given planned process, the associated realized plan specification is the one encompassing all changes made during execution. This means that all processes in which an agent acts towards achieving some objectives is a planned process. Bjoern Peters branch derived 6/11/9: Edited at workshop. Used to include: is initiated by an agent This class merges the previously separated objective driven process and planned process, as they the separation proved hard to maintain. (1/22/09, branch call) planned process planned process regulator role Fact sheet - Regulating the companies The role of the regulator. Ofwat is the economic regulator of the water and sewerage industry in England and Wales. http://www.ofwat.gov.uk/aptrix/ofwat/publish.nsf/Content/roleofregulator_factsheet170805 a regulatory role involved with making and/or enforcing relevant legislation and governmental orders Person:Jennifer Fostel regulator OBI regulator role regulatory role Regulatory agency, Ethics committee, Approval letter; example: Browse these EPA Regulatory Role subtopics http://www.epa.gov/ebtpages/enviregulatoryrole.html Feb 29, 2008 a role which inheres in material entities and is realized in the processes of making, enforcing or being defined by legislation or orders issued by a governmental body. GROUP: Role branch OBI, CDISC govt agents responsible for creating regulations; proxies for enforcing regulations. CDISC definition: regulatory authorities. Bodies having the power to regulate. NOTE: In the ICH GCP guideline the term includes the authorities that review submitted clinical data and those that conduct inspections. These bodies are sometimes referred to as competent regulatory role material supplier role Jackson Labs is an organization which provide mice as experimental material a role realized through the process of supplying materials such as animal subjects, reagents or other materials used in an investigation. Supplier role is a special kind of service, e.g. biobank PERSON:Jennifer Fostel material provider role supplier material supplier role classified data set A data set that is produced as the output of a class prediction data transformation and consists of a data set with assigned class labels. PERSON: James Malone PERSON: Monnie McGee data set with assigned class labels classified data set processed material Examples include gel matrices, filter paper, parafilm and buffer solutions, mass spectrometer, tissue samples Is a material entity that is created or changed during material processing. PERSON: Alan Ruttenberg processed material investigation Lung cancer investigation using expression profiling, a stem cell transplant investigation, biobanking is not an investigation, though it may be part of an investigation a planned process that consists of parts: planning, study design execution, documentation and which produce conclusion(s). Bjoern Peters OBI branch derived Could add specific objective specification Following OBI call November 2012,26th: it was decided there was no need for adding "achieves objective of drawing conclusion" as existing relations were providing equivalent ability. this note closes the issue and validates the class definition to be part of the OBI core editor = PRS study investigation material processing A cell lysis, production of a cloning vector, creating a buffer. A planned process which results in physical changes in a specified input material PERSON: Bjoern Peters PERSON: Frank Gibson PERSON: Jennifer Fostel PERSON: Melanie Courtot PERSON: Philippe Rocca Serra material transformation OBI branch derived material processing responsible party role he THERAPIST has the ability to print a separate statement for the patient and each responsible party. http://www.beaverlog.com/therapist/ez_support/billing/responsible_party_statements.htm a study personnel role played by a party who is accountable for the execution of a study component and can make decisions about the conduct of the study Person: Jennifer Fostel responsible party OBI responsible party role principal investigator role a responsible party role played by a person responsible for the overall conduct of a study Person: Jennifer Fostel principal investigator CDISC definition: A person responsible for the conduct of the clinical trial at a trial site. If a trial is conducted by a team of individuals at a trial site, the investigator is the responsible leader of the team and may be called the principal investigator. 2. The individual principal investigator. 2. The individual under whose immediate direction the test article is administered or dispensed to, or used involving, a subject, or, in the event of an investigation conducted by a team of individuals, is See also sponsor-investigator.; Leiter der klinischen Prufung.Under the German Drug Law, the physician who is head of the clinical investigation (CDISC): coordinating investigator (CDISC) (also study coordinator, MUSC); sponsor-investigator. An individual who both initiates and conducts, alone or with others, a clinical trial, and under whose immediate direction the investigational product is administered to, dispensed to, or used by a subject.NOTE: The term does not include any person other than an individual, hence not a corporation, agency (CDISC) principal investigator role specimen role liver section; a portion of a culture of cells; a nemotode or other animal once no longer a subject (generally killed); portion of blood from a patient. a role borne by a material entity that is gained during a specimen collection process and that can be realized by use of the specimen in an investigation 22Jun09. The definition includes whole organisms, and can include a human. The link between specimen role and study subject role has been removed. A specimen taken as part of a case study is not considered to be a population representative, while a specimen taken as representing a population, e.g. person taken from a cohort, blood specimen taken from an animal) would be considered a population representative and would also bear material sample role. Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation. blood taken from animal: animal continues in study, whereas blood has role specimen. something taken from study subject, leaves the study and becomes the specimen. parasite example - when parasite in people we study people, people are subjects and parasites are specimen - when parasite extracted, they become subject in the following study specimen can later be subject. GROUP: Role Branch OBI specimen role investigation agent role The person perform microarray experiments and submit microarray results (including raw data, processed data) with experiment description to ArrayExpress. A role borne by an entity and that is realized in a process that is part of an investigation in which an objective is achieved. These processes include, among others: planning, overseeing, funding, reviewing. Implementing a study means carrying out or performing the study and providing reagents or other materials used in the study and other tasks without which the study would not happen. Philly2013: Historically, this role would have been borne only by humans or organizations. However, we now also want to enable representing investigations run by robot scientists such as ADAM (King et al, Science, 2009) GROUP: Role Branch investigator OBI Feb 10, 2009. changes after discussion at OBI Consortium Workshop Feb 2-6, 2009. accepted as core term. study person role Philly2013: Historically, this role would have been borne only by humans or organizations. However, we now also want to enable investigations run by robot scientists such as ADAM (King et al, Science, 2009) investigation agent role organization PMID: 16353909.AAPS J. 2005 Sep 22;7(2):E274-80. Review. The joint food and agriculture organization of the United Nations/World Health Organization Expert Committee on Food Additives and its role in the evaluation of the safety of veterinary drug residues in foods. An entity that can bear roles, has members, and has a set of organization rules. Members of organizations are either organizations themselves or individual people. Members can bear specific organization member roles that are determined in the organization rules. The organization rules also determine how decisions are made on behalf of the organization by the organization members. BP: The definition summarizes long email discussions on the OBI developer, roles, biomaterial and denrie branches. It leaves open if an organization is a material entity or a dependent continuant, as no consensus was reached on that. The current placement as material is therefore temporary, in order to move forward with development. Here is the entire email summary, on which the definition is based: 1) there are organization_member_roles (president, treasurer, branch editor), with individual persons as bearers 2) there are organization_roles (employer, owner, vendor, patent holder) 3) an organization has a charter / rules / bylaws, which specify what roles there are, how they should be realized, and how to modify the charter/rules/bylaws themselves. It is debatable what the organization itself is (some kind of dependent continuant or an aggregate of people). This also determines who/what the bearer of organization_roles' are. My personal favorite is still to define organization as a kind of 'legal entity', but thinking it through leads to all kinds of questions that are clearly outside the scope of OBI. Interestingly enough, it does not seem to matter much where we place organization itself, as long as we can subclass it (University, Corporation, Government Agency, Hospital), instantiate it (Affymetrix, NCBI, NIH, ISO, W3C, University of Oklahoma), and have it play roles. This leads to my proposal: We define organization through the statements 1 - 3 above, but without an 'is a' statement for now. We can leave it in its current place in the is_a hierarchy (material entity) or move it up to 'continuant'. We leave further clarifications to BFO, and close this issue for now. PERSON: Alan Ruttenberg PERSON: Bjoern Peters PERSON: Philippe Rocca-Serra PERSON: Susanna Sansone GROUP: OBI organization protocol PCR protocol, has objective specification, amplify DNA fragment of interest, and has action specification describes the amounts of experimental reagents used (e..g. buffers, dNTPS, enzyme), and the temperature and cycle time settings for running the PCR. A plan specification which has sufficient level of detail and quantitative information to communicate it between investigation agents, so that different investigation agents will reliably be able to independently reproduce the process. PlanAndPlannedProcess Branch OBI branch derived + wikipedia (http://en.wikipedia.org/wiki/Protocol_%28natural_sciences%29) study protocol protocol interpreting data Concluding that a gene is upregulated in a tissue sample based on the band intensity in a western blot. Concluding that a patient has a infection based on measurement of an elevated body temperature and reported headache. Concluding that there were problems in an investigation because data from PCR and microarray are conflicting. Concluding that 'defects in gene XYZ cause cancer due to improper DNA repair' based on data from experiments in that study that gene XYZ is involved in DNA repair, and the conclusion of a previous study that cancer patients have an increased number of mutations in this gene. A planned process in which data gathered in an investigation is evaluated in the context of existing knowledge with the objective to generate more general conclusions or to conclude that the data does not allow one to draw general conclusion PERSON: Bjoern Peters PERSON: Jennifer Fostel Bjoern Peters drawing a conclusion based on data planning The process of a scientist thinking about and deciding what reagents to use as part of a protocol for an experiment. Note that the scientist could be human or a "robot scientist" executing software. a process of creating or modifying a plan specification 7/18/2011 BP: planning used to itself be a planned process. Barry Smith pointed out that this would lead to an infinite regression, as there would have to be a plan to conduct a planning process, which in itself would be the result of planning etc. Therefore, the restrictions on 'planning' were loosened to allow for informal processes that result in an 'ad hoc plan '. This required changing from 'has_specified_output some plan specifiction' to 'has_participant some plan specification'. Bjoern Peters Bjoern Peters Plans and Planned Processes Branch planning regulatory agency The US Environmental Protection Agency A regulatory agency is a organization that has responsibility over or for the legislation (acts and regulations) for a given sector of the government. GROUP: OBI Biomaterial Branch WEB: en.wikipedia.org/wiki/Regulator regulatory agency material transformation objective The objective to create a mouse infected with LCM virus. The objective to create a defined solution of PBS. an objective specifiction that creates an specific output object from input materials. PERSON: Bjoern Peters PERSON: Frank Gibson PERSON: Jennifer Fostel PERSON: Melanie Courtot PERSON: Philippe Rocca-Serra artifact creation objective GROUP: OBI PlanAndPlannedProcess Branch material transformation objective manufacturing Manufacturing is a process with the intent to produce a processed material which will have a function for future use. A person or organization (having manufacturer role) is a participant in this process Manufacturing implies reproducibility and responsibility AR This includes a single scientist making a processed material for personal use. PERSON: Bjoern Peters PERSON: Frank Gibson PERSON: Jennifer Fostel PERSON: Melanie Courtot PERSON: Philippe Rocca-Serra GROUP: OBI PlanAndPlannedProcess Branch manufacturing manufacturing objective is the objective to manufacture a material of a certain function (device) PERSON: Bjoern Peters PERSON: Frank Gibson PERSON: Jennifer Fostel PERSON: Melanie Courtot PERSON: Philippe Rocca-Serra GROUP: OBI PlanAndPlannedProcess Branch manufacturing objective study design execution injecting a mouse with PBS solution, weighing it, and recording the weight according to a study design. a planned process that carries out a study design removed axiom has_part some (assay or 'data transformation') per discussion on protocol application mailing list to improve reasoner performance. The axiom is still desired. branch derived 6/11/9: edited at workshop. Used to be: study design execution is a process with the objective to generate data according to a concretized study design. The execution of a study design is part of an investigation, and minimally consists of an assay or data transformation. study design execution manufacturer role With respect to The Accuri C6 Flow Cytometer System, the organization Accuri bears the role manufacturer role. With respect to a transformed line of tissue culture cells derived by a specific lab, the lab whose personnel isolated the cll line bears the role manufacturer role. With respect to a specific antibody produced by an individual scientist, the scientist who purifies, characterizes and distributes the anitbody bears the role manufacturer role. Manufacturer role is a role which inheres in a person or organization and which is realized by a manufacturing process. GROUP: Role Branch OBI manufacturer role clustered data set A clustered data set is the output of a K means clustering data transformation A data set that is produced as the output of a class discovery data transformation and consists of a data set with assigned discovered class labels. PERSON: James Malone PERSON: Monnie McGee data set with assigned discovered class labels AR thinks could be a data item instead clustered data set specimen collection process drawing blood from a patient for analysis, collecting a piece of a plant for depositing in a herbarium, buying meat from a butcher in order to measure its protein content in an investigation A planned process with the objective of collecting a specimen. Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation. Philly2013: A specimen collection can have as part a material entity acquisition, such as ordering from a bank. The distinction is that specimen collection necessarily involves the creation of a specimen role. However ordering cell lines cells from ATCC for use in an investigation is NOT a specimen collection, because the cell lines already have a specimen role. Philly2013: The specimen_role for the specimen is created during the specimen collection process. label changed to 'specimen collection process' on 10/27/2014, details see tracker: http://sourceforge.net/p/obi/obi-terms/716/ Bjoern Peters specimen collection 5/31/2012: This process is not necessarily an acquisition, as specimens may be collected from materials already in posession 6/9/09: used at workshop specimen collection process class prediction data transformation A class prediction data transformation (sometimes called supervised classification) is a data transformation that has objective class prediction. James Malone supervised classification data transformation PERSON: James Malone class prediction data transformation specimen collection objective The objective to collect bits of excrement in the rainforest. The objective to obtain a blood sample from a patient. A objective specification to obtain a material entity for potential use as an input during an investigation. Bjoern Peters Bjoern Peters specimen collection objective support vector machine A support vector machine is a data transformation with a class prediction objective based on the construction of a separating hyperplane that maximizes the margin between two data sets of vectors in n-dimensional space. James Malone Ryan Brinkman SVM PERSON: Ryan Brinkman support vector machine decision tree induction objective A decision tree induction objective is a data transformation objective in which a tree-like graph of edges and nodes is created and from which the selection of each branch requires that some type of logical decision is made. James Malone decision tree induction objective decision tree building data transformation A decision tree building data transformation is a data transformation that has objective decision tree induction. James Malone PERSON: James Malone decision tree building data transformation GenePattern software a software that provides access to more than 100 tools for gene expression analysis, proteomics, SNP analysis and common data processing tasks. James Malone Person:Helen Parkinson WEB: http://www.broadinstitute.org/cancer/software/genepattern/ GenePattern software peak matching Peak matching is a data transformation performed on a dataset of a graph of ordered data points (e.g. a spectrum) with the objective of pattern matching local maxima above a noise threshold James Malone Ryan Brinkman PERSON: Ryan Brinkman peak matching k-nearest neighbors A k-nearest neighbors is a data transformation which achieves a class discovery or partitioning objective, in which an input data object with vector y is assigned to a class label based upon the k closest training data set points to y; where k is the largest value that class label is assigned. James Malone k-NN PERSON: James Malone k-nearest neighbors CART A CART (classification and regression trees) is a data transformation method for producing a classification or regression model with a tree-based structure. James Malone classification and regression trees BOOK: David J. Hand, Heikki Mannila and Padhraic Smyth (2001) Principles of Data Mining. CART statistical model validation Using the expression levels of 20 proteins to predict whether a cancer patient will respond to a drug. A practical goal would be to determine which subset of the 20 features should be used to produce the best predictive model. - wikipedia A data transformation which assesses how the results of a statistical analysis will generalize to an independent data set. Helen Parkinson http://en.wikipedia.org/wiki/Cross-validation_%28statistics%29 statistical model validation manufacturer A person or organization that has a manufacturer role manufacturer service provider role Jackson Lab provides experimental animals, EBI provides training on databases, a core facility provides access to a DNA sequencer. is a role which inheres in a person or organization and is realized in in a planned process which provides access to training, materials or execution of protocols for an organization or person PERSON:Helen Parkinson service provider role processed specimen A tissue sample that has been sliced and stained for a histology study. A blood specimen that has been centrifuged to obtain the white blood cells. A specimen that has been intentionally physically modified. Bjoern Peters Bjoern Peters A tissue sample that has been sliced and stained for a histology study. processed specimen categorical label The labels 'positive' vs. 'negative', or 'left handed', 'right handed', 'ambidexterous', or 'strongly binding', 'weakly binding' , 'not binding', or '+++', '++', '+', '-' etc. form scales of categorical labels. A label that is part of a categorical datum and that indicates the value of the data item on the categorical scale. Bjoern Peters Bjoern Peters categorical label device A voltmeter is a measurement device which is intended to perform some measure function. An autoclave is a device that sterlizes instruments or contaminated waste by applying high temperature and pressure. A material entity that is designed to perform a function in a scientific investigation, but is not a reagent. 2012-12-17 JAO: In common lab usage, there is a distinction made between devices and reagents that is difficult to model. Therefore we have chosen to specifically exclude reagents from the definition of "device", and are enumerating the types of roles that a reagent can perform. 2013-6-5 MHB: The following clarifications are outcomes of the May 2013 Philly Workshop. Reagents are distinguished from devices that also participate in scientific techniques by the fact that reagents are chemical or biological in nature and necessarily participate in some chemical interaction or reaction during the realization of their experimental role. By contrast, devices do not participate in such chemical reactions/interactions. Note that there are cases where devices use reagent components during their operation, where the reagent-device distinction is less clear. For example: (1) An HPLC machine is considered a device, but has a column that holds a stationary phase resin as an operational component. This resin qualifies as a device if it participates purely in size exclusion, but bears a reagent role that is realized in the running of a column if it interacts electrostatically or chemically with the evaluant. The container the resin is in (“the column”) considered alone is a device. So the entire column as well as the entire HPLC machine are devices that have a reagent as an operating part. (2) A pH meter is a device, but its electrode component bears a reagent role in virtue of its interacting directly with the evaluant in execution of an assay. (3) A gel running box is a device that has a metallic lead as a component that participates in a chemical reaction with the running buffer when a charge is passed through it. This metallic lead is considered to have a reagent role as a component of this device realized in the running of a gel. In the examples above, a reagent is an operational component of a device, but the device itself does not realize a reagent role (as bearing a reagent role is not transitive across the part_of relation). In this way, the asserted disjointness between a reagent and device holds, as both roles are never realized in the same bearer during execution of an assay. PERSON: Helen Parkinson instrument OBI development call 2012-12-17. device questionnaire A document with a set of printed or written questions with a choice of answers, devised for the purposes of a survey or statistical study. JT: It plays a role in collecting data that could be fleshed out more; but I'm thinking it is, in itself, an edited document. JZ: based on textual definition of edited document, it can be defined as N&S. I prefer to leave questionnaire as a document now. We can add more restrictions in the future and use that to determine it is an edited document or not. Need to clarify if this is a document or a directive information entity (or what their connection is)) PERSON: Jessica Turner Merriam-Webster questionnaire selective organism creation objective an objective specification to generate a population or type of organism within species that have some uniform behavioral, morphological, physiological, or genetic characteristics with similarly bred organisms. PERSON: Chris Stoeckert, Jie Zheng WEB: wikipedia http://en.wikipedia.org/wiki/Cultivar http://en.wikipedia.org/wiki/Ecotype http://en.wikipedia.org/wiki/Strain_%28biology%29 selective organism creation objective selectively maintained organism An organism that is bred to have some uniform behavioral, morphological, physiological, or genetic characteristics with similarly bred organisms Bjoern Peters, Helen Parkinson, Philippe Rocca-Serra, Jie Zheng, Chris Stoeckert cultivar ecotype strain MO_9 StrainOrLine, MO_71 Ecotype, MO_124 Cultivar selectively maintained organism specimen from organism A specimen that derives from an anatomical part or substance arising from an organism. Examples of tissue specimen include tissue, organ, physiological system, blood, or body location (arm). PERSON: Chris Stoeckert, Jie Zheng tissue specimen MO_954 organism_part specimen from organism conclusion based on data The conclusion that a gene is upregulated in a tissue sample based on the band intensity in a western blot. The conclusion that a patient has a infection based on measurement of an elevated body temperature and reported headache. The conclusion that there were problems in an investigation because data from PCR and microarray are conflicting. The following are NOT conclusions based on data: data themselves; results from pure mathematics, e.g. "13 is prime". An information content entity that is inferred from data. In the Philly 2013 workshop, we recognized the limitations of "conclusion textual entity", and we introduced this as more general. The need for the 'textual entity' term going forward is up for future debate. Group:2013 Philly Workshop group Group:2013 Philly Workshop group conclusion based on data categorical value specification A value specification that is specifies one category out of a fixed number of nominal categories PERSON:Bjoern Peters categorical value specification value specification The value of 'positive' in a classification scheme of "positive or negative"; the value of '20g' on the quantitative scale of mass. An information content entity that specifies a value within a classification scheme or on a quantitative scale. This term is currently a descendant of 'information content entity', which requires that it 'is about' something. A value specification of '20g' for a measurement data item of the mass of a particular mouse 'is about' the mass of that mouse. However there are cases where a value specification is not clearly about any particular. In the future we may change 'value specification' to remove the 'is about' requirement. PERSON:Bjoern Peters value specification collection of specimens Blood cells collected from multiple donors over the course of a study. A material entity that has two or more specimens as its parts. Details see tracker: https://sourceforge.net/p/obi/obi-terms/778/ Person: Chris Stoeckert, Jie Zheng OBIB, OBI Biobank collection of specimens histologic grade according to AJCC 7th edition G1:Well differentiated G4: Undifferentiated A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the American Joint Committee on Cancer (AJCC) 7th Edition grading system. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB histologic grade according to AJCC 7th edition histologic grade according to the Fuhrman Nuclear Grading System A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the Fuhrman Nuclear Grading System. Chris Stoeckert, Helena Ellis Histologic Grade (Fuhrman Nuclear Grading System) NCI BBRB, OBI NCI BBRB histologic grade according to the Fuhrman Nuclear Grading System histologic grade for ovarian tumor A categorical value specification that is a histologic grade assigned to a ovarian tumor. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB histologic grade for ovarian tumor histologic grade for ovarian tumor according to a two-tier grading system A histologic grade for ovarian tumor that is from a two-tier histological classification of tumors. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB histologic grade for ovarian tumor according to a two-tier grading system histologic grade for ovarian tumor according to the World Health Organization A histologic grade for ovarian tumor that is from a histological classification by the World Health Organization (WHO). Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB histologic grade for ovarian tumor according to the World Health Organization pathologic primary tumor stage for colon and rectum according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis pT: Pathologic spread colorectal primary tumor (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic primary tumor stage for colon and rectum according to AJCC 7th edition pathologic primary tumor stage for lung according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis pT: Pathologic spread lung primary tumor (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic primary tumor stage for lung according to AJCC 7th edition pathologic primary tumor stage for kidney according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis pT: Pathologic spread kidney primary tumor (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic primary tumor stage for kidney according to AJCC 7th edition pathologic primary tumor stage for ovary according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis pT: Pathologic spread ovarian primary tumor (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic primary tumor stage for ovary according to AJCC 7th edition pathologic lymph node stage for colon and rectum according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes. Chris Stoeckert, Helena Ellis pN: Pathologic spread colon lymph nodes (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic lymph node stage for colon and rectum according to AJCC 7th edition pathologic lymph node stage for lung according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes. Chris Stoeckert, Helena Ellis pN: Pathologic spread colon lymph nodes (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic lymph node stage for lung according to AJCC 7th edition pathologic lymph node stage for kidney according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes. Chris Stoeckert, Helena Ellis pN: Pathologic spread kidney lymph nodes (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic lymph node stage for kidney according to AJCC 7th edition pathologic lymph node stage for ovary according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes. Chris Stoeckert, Helena Ellis pN: Pathologic spread ovarian lymph nodes (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic lymph node stage for ovary according to AJCC 7th edition pathologic distant metastases stage for colon according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of colon cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis M: colon distant metastases (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic distant metastases stage for colon according to AJCC 7th edition pathologic distant metastases stage for lung according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis M: lung distant metastases (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic distant metastases stage for lung according to AJCC 7th edition pathologic distant metastases stage for kidney according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis M: kidney distant Metastases (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic distant metastases stage for kidney according to AJCC 7th edition pathologic distant metastases stage for ovary according to AJCC 7th edition A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery. Chris Stoeckert, Helena Ellis M: ovarian distant metastases (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB pathologic distant metastases stage for ovary according to AJCC 7th edition clinical tumor stage group according to AJCC 7th edition A categorical value specification that is an assessment of the stage of a cancer according to the American Joint Committee on Cancer (AJCC) v7 staging systems. Chris Stoeckert, Helena Ellis Clinical tumor stage group (AJCC 7th Edition) NCI BBRB, OBI NCI BBRB clinical tumor stage group according to AJCC 7th edition International Federation of Gynecology and Obstetrics cervical cancer stage value specification A categorical value specification that is an assessment of the stage of a gynecologic cancer according to the International Federation of Gynecology and Obstetrics (FIGO) staging systems. Chris Stoeckert, Helena Ellis Clinical FIGO stage NCI BBRB, OBI NCI BBRB International Federation of Gynecology and Obstetrics cervical cancer stage value specification International Federation of Gynecology and Obstetrics ovarian cancer stage value specification A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the FIGO classification system. Chris Stoeckert, Helena Ellis Pathologic Tumor Stage Grouping for ovarian cancer (FIGO) NCI BBRB, OBI NCI BBRB International Federation of Gynecology and Obstetrics ovarian cancer stage value specification performance status value specification A categorical value specification that is an assessment of a participant's performance status (general well-being and activities of daily life). Chris Stoeckert, Helena Ellis Performance Status Scale https://en.wikipedia.org/wiki/Performance_status NCI BBRB performance status value specification Eastern Cooperative Oncology Group score value specification A performance status value specification designed by the Eastern Cooperative Oncology Group to assess disease progression and its affect on the daily living abilities of the patient. Chris Stoeckert, Helena Ellis ECOG score NCI BBRB, OBI NCI BBRB Eastern Cooperative Oncology Group score value specification Karnofsky score vaue specification A performance status value specification designed for classifying patients 16 years of age or older by their functional impairment. Chris Stoeckert, Helena Ellis Karnofsky Score NCI BBRB, OBI NCI BBRB Karnofsky score vaue specification material supplier A person or organization that provides material supplies to other people or organizations. Rebecca Jackson https://github.com/obi-ontology/obi/issues/1289 material supplier organism animal fungus plant virus A material entity that is an individual living system, such as animal, plant, bacteria or virus, that is capable of replicating or reproducing, growth and maintenance in the right environment. An organism may be unicellular or made up, like humans, of many billions of cells divided into specialized tissues and organs. 10/21/09: This is a placeholder term, that should ideally be imported from the NCBI taxonomy, but the high level hierarchy there does not suit our needs (includes plasmids and 'other organisms') 13-02-2009: OBI doesn't take position as to when an organism starts or ends being an organism - e.g. sperm, foetus. This issue is outside the scope of OBI. Stub class to serve as root of hierarchy for imports from NCBI Taxonomy. GROUP: OBI Biomaterial Branch WEB: http://en.wikipedia.org/wiki/Organism organism organism specimen Biobanking of blood taken and stored in a freezer for potential future investigations stores specimen. A material entity that has the specimen role. Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation. PERSON: James Malone PERSON: Philippe Rocca-Serra GROUP: OBI Biomaterial Branch specimen data transformation The application of a clustering protocol to microarray data or the application of a statistical testing method on a primary data set to determine a p-value. A planned process that produces output data from input data. Elisabetta Manduchi Helen Parkinson James Malone Melanie Courtot Philippe Rocca-Serra Richard Scheuermann Ryan Brinkman Tina Hernandez-Boussard data analysis data processing Branch editors data transformation leave one out cross validation method The authors conducted leave-one-out cross validation to estimate the strength and accuracy of the differentially expressed filtered genes. http://bioinformatics.oxfordjournals.org/cgi/content/abstract/19/3/368 is a data transformation : leave-one-out cross-validation (LOOCV) involves using a single observation from the original sample as the validation data, and the remaining observations as the training data. This is repeated such that each observation in the sample is used once as the validation data 2009-11-10. Tracker: https://sourceforge.net/tracker/?func=detail&aid=2893049&group_id=177891&atid=886178 Person:Helen Parkinson leave one out cross validation method k-means clustering A k-means clustering is a data transformation which achieves a class discovery or partitioning objective, which takes as input a collection of objects (represented as points in multidimensional space) and which partitions them into a specified number k of clusters. The algorithm attempts to find the centers of natural clusters in the data. The most common form of the algorithm starts by partitioning the input points into k initial sets, either at random or using some heuristic data. It then calculates the mean point, or centroid, of each set. It constructs a new partition by associating each point with the closest centroid. Then the centroids are recalculated for the new clusters, and the algorithm repeated by alternate applications of these two steps until convergence, which is obtained when the points no longer switch clusters (or alternatively centroids are no longer changed). Elisabetta Manduchi James Malone Philippe Rocca-Serra WEB: http://en.wikipedia.org/wiki/K-means k-means clustering hierarchical clustering A hierarchical clustering is a data transformation which achieves a class discovery objective, which takes as input data item and builds a hierarchy of clusters. The traditional representation of this hierarchy is a tree (visualized by a dendrogram), with the individual input objects at one end (leaves) and a single cluster containing every object at the other (root). James Malone WEB: http://en.wikipedia.org/wiki/Data_clustering#Hierarchical_clustering hierarchical clustering dimensionality reduction A dimensionality reduction is data partitioning which transforms each input m-dimensional vector (x_1, x_2, ..., x_m) into an output n-dimensional vector (y_1, y_2, ..., y_n), where n is smaller than m. Elisabetta Manduchi James Malone Melanie Courtot Philippe Rocca-Serra data projection PERSON: Elisabetta Manduchi PERSON: James Malone PERSON: Melanie Courtot dimensionality reduction principal components analysis dimensionality reduction A principal components analysis dimensionality reduction is a dimensionality reduction achieved by applying principal components analysis and by keeping low-order principal components and excluding higher-order ones. Elisabetta Manduchi James Malone Melanie Courtot Philippe Rocca-Serra pca data reduction PERSON: Elisabetta Manduchi PERSON: James Malone PERSON: Melanie Courtot principal components analysis dimensionality reduction data visualization Generation of a heatmap from a microarray dataset An planned process that creates images, diagrams or animations from the input data. Elisabetta Manduchi James Malone Melanie Courtot Tina Boussard data encoding as image visualization PERSON: Elisabetta Manduchi PERSON: James Malone PERSON: Melanie Courtot PERSON: Tina Boussard Possible future hierarchy might include this: information_encoding >data_encoding >>image_encoding data visualization data transformation objective normalize objective An objective specification to transformation input data into output data Modified definition in 2013 Philly OBI workshop James Malone PERSON: James Malone data transformation objective partitioning data transformation A partitioning data transformation is a data transformation that has objective partitioning. James Malone PERSON: James Malone partitioning data transformation partitioning objective A k-means clustering which has partitioning objective is a data transformation in which the input data is partitioned into k output sets. A partitioning objective is a data transformation objective where the aim is to generate a collection of disjoint non-empty subsets whose union equals a non-empty input set. Elisabetta Manduchi James Malone PERSON: Elisabetta Manduchi partitioning objective class discovery data transformation A class discovery data transformation (sometimes called unsupervised classification) is a data transformation that has objective class discovery. James Malone clustering data transformation unsupervised classification data transformation PERSON: James Malone class discovery data transformation class discovery objective A class discovery objective (sometimes called unsupervised classification) is a data transformation objective where the aim is to organize input data (typically vectors of attributes) into classes, where the number of classes and their specifications are not known a priori. Depending on usage, the class assignment can be definite or probabilistic. James Malone clustering objective discriminant analysis objective unsupervised classification objective PERSON: Elisabetta Manduchi PERSON: James Malone class discovery objective class prediction objective A class prediction objective (sometimes called supervised classification) is a data transformation objective where the aim is to create a predictor from training data through a machine learning technique. The training data consist of pairs of objects (typically vectors of attributes) and class labels for these objects. The resulting predictor can be used to attach class labels to any valid novel input object. Depending on usage, the prediction can be definite or probabilistic. A classification is learned from the training data and can then be tested on test data. James Malone classification objective supervised classification objective PERSON: Elisabetta Manduchi PERSON: James Malone class prediction objective cross validation objective A cross validation objective is a data transformation objective in which the aim is to partition a sample of data into subsets such that the analysis is initially performed on a single subset, while the other subset(s) are retained for subsequent use in confirming and validating the initial analysis. James Malone rotation estimation objective WEB: http://en.wikipedia.org/wiki/Cross_validation cross validation objective clustered data visualization A data visualization which has input of a clustered data set and produces an output of a report graph which is capable of rendering data of this type. James Malone clustered data visualization study design a matched pairs study design describes criteria by which subjects are identified as pairs which then undergo the same protocols, and the data generated is analyzed by comparing the differences between the paired subjects, which constitute the results of the executed study design. A plan specification comprised of protocols (which may specify how and what kinds of data will be gathered) that are executed as part of an investigation and is realized during a study design execution. Editor note: there is at least an implicit restriction on the kind of data transformations that can be done based on the measured data available. PERSON: Chris Stoeckert experimental design rediscussed at length (MC/JF/BP). 12/9/08). The definition was clarified to differentiate it from protocol. study design A material entity which is clinically abnormal and part of an extended organism. Disorders are the physical basis of disease. disorder An object aggregate all of whose components are human beings. An object aggregate all of whose components are human beings. collection of humans 2 An object aggregate that is not itself an organization and whose members are only organizations that have some feature in common William R. Hogan Amanda Hicks It is often convenient to group organizations together that otherwise might not even interact with one another. aggregate of organizations material entity role A dependent entity that inheres in a bearer by virtue of how the bearer is related to other entities quality (PATO) PATO:0000001 quality A dependent entity that inheres in a bearer by virtue of how the bearer is related to other entities PATOC:GVG Examples include: population, community, species (meaning the collection of organisms that makes up a species, not the taxonomic rank), and family. A material entity that consists of two or more organisms, viruses, or viroids. group of organism organism collection collection of organisms The Apollo spacecraft took 24 astronauts to the Moon between 1968 and 1972. Vehicles, crewed or uncrewed, which are designed to orbit about the Earth or another celestial body or be placed into a trajectory to another celestial body or location in space. NASA Thesaurus, 1988 spacecraft A PDS data product from the PDS 3 data model. PDS data is tricky as while PDS3 has the concept of a data set; PDS4 doesn't really. You have to find Collections that have a collection_type of data. pds_Data_Set_PDS3 A PDS data product from the PDS 3 data model. Examples are line plots and spectrograms. A graphical representation of data wherein the underlying numeric values are not (readily) accessible for analysis. spase:DisplayData A graphical representation of data wherein the underlying numeric values are not (readily) accessible for analysis. Catalogs include lists of events, files in a product, and data availability. A tabular listing of events or observational notes, especially those that have utility in aiding a user in locating data. spase:Catalog A tabular listing of events or observational notes, especially those that have utility in aiding a user in locating data. Data stored as numerical values in one or more specified formats. spase:NumericalData Data stored as numerical values in one or more specified formats. A product from the PDS data system 2022-04-04T23:21:32Z PDSDataProduct PDS data product A PDS data product from the PDS 4 data model. 2022-04-04T23:25:25Z In the PDS 4 data model, only the collections that have a type of data point directly to data. Most other types point to other kinds of information products. pds_Collection_with_Type_Data An interface that 1) presents users with discovery criteria and may 2) lead to an access interface. 2022-04-15T23:48:19Z discovery interface An interface that 1) presents users with discovery criteria and may 2) lead to an access interface. A campaign that is coordinated among one or more individuals and/or one or more organizations. 2022-04-15T23:55:00Z Field campaigns are often characterized by in situ terrestrial field work. field campaign A campaign that is coordinated among one or more individuals and/or one or more organizations. A set of experiments and/or observations. 2022-04-16T00:07:39Z investigation A set of experiments and/or observations. https://pds.nasa.gov/datastandards/documents/dd/current/PDS4_PDS_DD_1F00/webhelp/all/#ch05s850.html For example, the International Halley Watch mobilized observatories around the world for collection of data during the most recent apparition of Comet Halley. The Shoemaker-Levy-9 (SL9) campaign used both Earth-based and spacecraft instruments to monitor the SL9 impact on Jupiter. A campaign that 1) uses primarily but not exclusively existing facilities and 2) after and possibly during which other investigations are carried out using the same facilities. 2022-04-16T00:23:16Z observing campaign A campaign that 1) uses primarily but not exclusively existing facilities and 2) after and possibly during which other investigations are carried out using the same facilities. A coronal mass ejection, supernova, earthquake, spacecraft launch, etc. Something observable that happened at a given time and place Adapted from http://purl.obolibrary.org/obo/NCIT_C25499 event A single science campaign may require all or part of several missions. There may be several science campaigns occurring over the course of a single mission. A systematic set of activities undertaken to meet a particular science objective. science campaign Morris, Robert, Jennifer Dungan, Lina Khatib, A. Bachman, John Gasch, Paul Hempel, Jenny Williams, Terri Wood, and Christopher Bruno. "Coordinated science campaign planning for earth observing missions." In Proc. of ESTC’04. 2004. campaign An assay is an investigative (analytic) procedure for qualitatively assessing or quantitatively measuring the presence, amount, or functional activity of a target entity. assay A product containing science data from some investigation. data set dataProduct It is generally agreed that data is in the eye of the beholder; but, for the purposes of this project the terms data and data product are limited to traditional mostly numeric science data products that NASA holds and actually calls data or data products. Thus a DataProductService is any product or service that returns science data, normally compiled into a set according to shared characteristics. data product A product containing science data from some investigation. NASA (2012) NASA Thesaurus: Hierarchical Listing with Definitions. Vol 1, NASA. The mechanical, magnetic, electronic, and electrical equipment necessary for conducting an activity. Hardware is usually distinguished from the theory and design that make the activity possible. hardware An originator or creator of a work author A government agency engaged in activities related to outer space and space exploration. space agency A government agency engaged in activities related to outer space and space exploration. A spacecraft, a person, a ship, a piece of laboratory equipment The physical object upon or within which an instrument is mounted. platform instrument host The physical object upon or within which an instrument is mounted. "mouse", "Mus musculus", "rodent", "mammal", "microorganism", "fungi" The quality of a living subject that indicates the taxonomical grouping of the subject. This grouping can be at any level in a hierachy of organism classification, or a collection of levels, and can be using scientific language or colloquial language. Rduerr 2021-11-30T21:34:56.970241Z organism MOD10A1 data files; structured metadata files; data landing page; scientific report; an API that provides search and access to a particular satellite's data; an application for displaying or analyzing data; a movie of a solar flare, images of the MODIS instrument, the Terra satellite, an astronaut, etc. Any offered product or service. Peter Fox product Any offered product or service. A data product from the GeneLab repository Rduerr 2021-12-01T20:52:05.98268Z study Gender is known to be a factor in the study of high blood pressure. The role played by an entity as part of a scientific investigation such that levels of the measurement or observation of the entity are thought to bear upon the hypotheses being investigated. 0000-0003-4312-9552 factor A software interface that 1) presents users with selection criteria and 2) presents products or services that meet the criteria the user then selects. access interface A software interface that 1) presents users with selection criteria and 2) presents products or services that meet the criteria the user then selects. For example, a series of related laboratory experiments/observations conducted by a small university team and funded through a single proposal could be an Individual Investigation. Library research by one person on previously published results to distill common conclusions could also be an Individual Investigation. An investigation that 1) uses existing facilities and 2) is under the direction of a single individual. individual investigation research study research investigation An investigation that 1) uses existing facilities and 2) is under the direction of a single individual. A part of a feature, taken to demonstrate or to determine the character of the whole. Rduerr 2021-11-30T21:35:20.533927Z sample specimen A preparation of tissue or bodily fluid taken for examination or diagnosis. A part of a feature, taken to demonstrate or to determine the character of the whole. Adapted from http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19157 A product that describes some entity. information product Hardware used in conducting an experiment. experimentApparatus experiment Apparatus The realisation of an application, or execution of a plan, idea, model, design, specification, standard, algorithm, or policy. deployment An information content entity that 1) contains a set of machine-readable instructions (most often in the form of a computer program) that 2) conform to a given syntax (sometimes referred to as a language) that 3) is interpretable by a given processor and that 4) directs a computer's processor to perform specific operations. software A role in which the bearer delivers financial support to enable some activity. funder An identified configuration for an instrument. instrumentOperatingMode Instrument operating modes may include both hardware configurations (e.g., for instruments with multiple filters) as well as software configurations (e.g., to control how long an exposure should last). Some instruments have many such modes, others may only have one. instrument operating mode For example: (1) the NASA Voyager mission launched two spacecraft to Jupiter and Saturn; (2) the Deep Impact (DI) mission launched a spacecraft, part of which impacted the comet Tempel 2; and (3) the EPOXI mission redefined the objectives of the surviving DI hardware for further exploration of the solar system. Coordinated tasks and operations undertaken to meet a set of specific objectives, within clearly delineated time and location constraints. Discussion by SDDO project team mission Coordinated tasks and operations undertaken to meet a set of specific objectives, within clearly delineated time and location constraints. Any procedure that involves testing or manipulating a sample or subject in a laboratory setting A broadened version of http://purl.obolibrary.org/obo/NCIT_C25294 laboratoryProcedure An agent that is a human being. person An agent that is a human being. A mission led or funded by NASA Per the NASA SMD glossary at https://science.nasa.gov/glossary/ a mission is a "NASA Science-funded activity with the purpose of meeting goals laid out by presidential directive, and detailed in Science Mission Directorate's strategic plan." This would mean the ontology would need to include the concepts of a presidential directive and a strategic plan - wait for a use case before implementing this change. SDDO team NASAMission A camera, MODIS, a survey instrument (e.g., google form) An instrument is a physical object that can be used to collect data. Adapted from pds:Instrument instrument A plan for a coordinated set of actions and observations designed to generate data, with the ultimate goal of discovery or hypothesis testing. Added the phrase "plan for a" to the front of the definition per Dan's request adapted from http://purl.obolibrary.org/obo/NCIT_C42790 experiment An information product that contains structured metadata. metadata metadataProduct While agreed that metadata is just data about data and so is really an unneeded term, we recognize that the term metadata is often applied to information about data no matter its form. In many cases, a metadata product is available for access, even if the data is not. metadata product A material entity that has characteristics that can be qualified or quantified through observation or experiment. Depending on the context, individual entities such as a human or star, may be either features or specimens - depending on whether you are interested in studying the entire class of humans or stars, or a particular star or human. feature Mars, a hurricane, the aurora, a molecular cloud, a sunspot, a mouse, its liver, etc. An observatory or laboratory A construction, permanent or temporary, on land, in air, space or water, where scientific research or measurements can be undertaken. facility A construction, permanent or temporary, on land, in air, space or water, where scientific research or measurements can be undertaken. A fact or situation that is observed to exist. phenomenon A fact or situation that is observed to exist. Act of carrying out an procedure to estimate or calculate a value of a property of a feature. observation Act of carrying out an procedure to estimate or calculate a value of a property of a feature. A graphical user interface that provides access to photographs/images. photoGallery An entity that can bear roles, has members, and has a set of organization rules. organization Rduerr 2021-11-30T19:43:39.350414Z A role which inheres in a person or organization and which is realized during an investigation. investigator A broad framework of goals to be achieved. program A broad framework of goals to be achieved. A written or printed paper that bears the original, official, or legal form of something and can be used to furnish decisive evidence or information. May be electronic or physical paper. document Journal articles, technical or other reports, books, etc. A written or printed paper that bears the original, official, or legal form of something and can be used to furnish decisive evidence or information. The American Heritage® Dictionary of the English Language, 5th Edition. data element The meaning of a column within a spreadsheet (e.g., identifier or height); the meaning of each pixel in an image (e.g., surface temperature)|another test example A data element is any characteristic that can help in understanding data content. That is, a data element is any parameter or variable that is useful, or critical, when identifying or describing the content of a data object. data element Software that provides the low-level control for a device's specific hardware. firmware NASA program A type of document, physical or digital, comprised of data and/or analytical assessment related to a scientific protocol. Scientific documents can be referenced or included in publicationDocuments. scientific results Any document (electronic or written record) that is about an experiment process (limited to the conduct of the experiment) 0 experiment document Any document (electronic or written record) that is about an experiment process (limited to the conduct of the experiment) Modified from definition of http://purl.obolibrary.org/obo/NCIT_C142425 A data product that is an aggregate of data items of the same type that have something in common. Averages and distributions can be determined for data sets. space life sciences dataset A data product that is an aggregate of data items of the same type that have something in common. Averages and distributions can be determined for data sets. Derived from http://purl.obolibrary.org/obo/IAO_0000100 A coordinated set of actions and observations designed to generate data, with the ultimate goal of discovery or hypothesis testing. experiment A coordinated set of actions and observations designed to generate data, with the ultimate goal of discovery or hypothesis testing. https://ncit.nci.nih.gov/ncitbrowser/pages/concept_details.jsf?dictionary=NCI_Thesaurus&version=22.04d&code=C42790&ns=ncit&type=properties&key=n2047960635&b=1&n=0&vse=null A document that is about an item of hardware. For LSDA, hardware documents include hardware design, manufacturing, and operations documents hardware document An individual who conducts scientific research. The investigator collects and analyses data and study documents, and provides reports in compliance with applicable requirements investigator (human) An individual who conducts scientific research. The investigator collects and analyses data and study documents, and provides reports in compliance with applicable requirements Modified from http://purl.obolibrary.org/obo/NCIT_C25936 A document that is about a project. For LSDA, project documents include project operations, schedules, and other related documents. project document A federally funded facility where NASA activities are undertaken. This would include JPL and other federally funded Centers. Is that in line with NGLSDA usage? nasa center A federally funded facility where NASA activities are undertaken. Modified from http://purl.obolibrary.org/obo/ENVO_00000469 Semantic Type: Conceptual Entity NCIt Definition: A broad framework of goals to be achieved. Semantic Type: Organization: NCIt Definition: The principal administrative organization responsible for the research conducted. program Semantic Type: Conceptual Entity NCIt Definition: A broad framework of goals to be achieved. Semantic Type: Organization: NCIt Definition: The principal administrative organization responsible for the research conducted. https://www.ontobee.org/ontology/NCIT?iri=http://purl.obolibrary.org/obo/NCIT_C52647 https://www.ontobee.org/ontology/NCIT?iri=http://purl.obolibrary.org/obo/NCIT_C63409 NCIt Definition: A physical object, or electronic counterpart, that is characterized by containing writing which is meant to be human-readable. "By this definition no binary files are documents (we assume they become dataset files in NGLSDA)" LSDA document NCIt Definition: A physical object, or electronic counterpart, that is characterized by containing writing which is meant to be human-readable. for NCit: https://www.ontobee.org/ontology/NCIT?iri=http://purl.obolibrary.org/obo/NCIT_C19498https://ncimetathesaurus.nci.nih.gov/ncimbrowser/ConceptReport.jsp?dictionary=NCI%20Metathesaurus&code=CL414404 A document that is an affine projection to a two dimensional surface, of EM spectrum radiation or measurements of some quality of an entity or entities repeated at regular intervals across a spatial range (where the measurements are represented as color and luminosity on the projected surface.) Modified from IAO image definition and document relationship. image (LSDA) A document that is an affine projection to a two dimensional surface, of EM spectrum radiation or measurements of some quality of an entity or entities repeated at regular intervals across a spatial range (where the measurements are represented as color and luminosity on the projected surface.) NCI Metathesaurus (nih.gov) The International Standard Payload Rack (ISPR) is a steel framework container that is designed and been adopted by the International Space Station (ISS) program to support efficient integration and interchangeability of space payload hardware, such as machines and experiment payload The International Standard Payload Rack (ISPR) is a steel framework container that is designed and been adopted by the International Space Station (ISS) program to support efficient integration and interchangeability of space payload hardware, such as machines and experiment https://home.iss.nasa.gov/home/ (under Research/Payloads) https://iss-science.jsc.nasa.gov/home Persons employed in any field. personnel Persons employed in any field. http://purl.obolibrary.org/obo/NCIT_C60758 Devices, manned and unmanned, which are designed to be placed into an orbit about the Earth or into a trajectory to another celestial body. spacecraft Devices, manned and unmanned, which are designed to be placed into an orbit about the Earth or into a trajectory to another celestial body. https://ncimetathesaurus.nci.nih.gov/ncimbrowser/ConceptReport.jsp?dictionary=NCI%20Metathesaurus&code=C0242743 Any material sample taken from a biological entity for testing, diagnostic, propagation, treatment or research purposes, including a sample obtained from a living organism or taken from the biological object after halting of all its life functions. Biospecimen can contain one or more components including but not limited to cellular molecules, cells, tissues, organs, body fluids, embryos, and body excretory products Note that any whole entity cannot be a biospecimen biospecimen Any material sample taken from a biological entity for testing, diagnostic, propagation, treatment or research purposes, including a sample obtained from a living organism or taken from the biological object after halting of all its life functions. Biospecimen can contain one or more components including but not limited to cellular molecules, cells, tissues, organs, body fluids, embryos, and body excretory products Modified from NCIT: http://purl.obolibrary.org/obo/NCIT_C70699 An entity of interest, either biological or otherwise. EXAMPLE(S): A human being who might be of interest because they are on a study, a sheep who might have experienced an adverse event, or a pacemaker that failed. An entity, either biologic or otherwise, of interest in an investigation. [Definition Source: NCI] subject An entity of interest, either biological or otherwise. EXAMPLE(S): A human being who might be of interest because they are on a study, a sheep who might have experienced an adverse event, or a pacemaker that failed. An entity, either biologic or otherwise, of interest in an investigation. [Definition Source: NCI] From investigative subject: http://purl.obolibrary.org/obo/NCIT_C79916 A set of related data (either written or electronic) and is a part of a dataset dataset file A set of related data (either written or electronic) and is a part of a dataset Derived from http://purl.obolibrary.org/obo/NCIT_C42883 An item of hardware that is a part of another item of hardware. component An item of hardware that is a part of another item of hardware. Loosely derived from NCIT A physical, manufactured or otherwise processed object that is used in a scientific investigation or clinical activity. hardware A physical, manufactured or otherwise processed object that is used in a scientific investigation or clinical activity. NCI Metathesaurus (nih.gov) Coordinated tasks and operations undertaken to meet a set of specific scientific or technical objectives, within clearly delineated time and location constraints. research mission Coordinated tasks and operations undertaken to meet a set of specific scientific or technical objectives, within clearly delineated time and location constraints. Modified from SMD Catalog definition of Mission NCIt Definition: A printed or electronic work offered for distribution. MSH Definition: Copies of a work or document distributed to the public by sale, rental, lease, or lending. (From ALA Glossary of Library and Information Science, 1983, p181) CSP Definition: copy or copies of a document offered for distribution; includes the preparation of the documented material. publication document NCIt Definition: A printed or electronic work offered for distribution. MSH Definition: Copies of a work or document distributed to the public by sale, rental, lease, or lending. (From ALA Glossary of Library and Information Science, 1983, p181) CSP Definition: copy or copies of a document offered for distribution; includes the preparation of the documented material. https://ncimetathesaurus.nci.nih.gov/ncimbrowser/ConceptReport.jsp?dictionary=NCI%20Metathesaurus&code=C0034036 A bounded physical or digital representation of a body of information designed with the capacity (and usually intent) to communicate a particular subject, art, craft, technique, applied science and/or industrial service. technical paper A bounded physical or digital representation of a body of information designed with the capacity (and usually intent) to communicate a particular subject, art, craft, technique, applied science and/or industrial service. https://semanticscience.org/resource/SIO_000148.rdf NPD 2200.1C - https://www.nasa.gov/sites/default/files/atoms/files/n_pd_2200_001c_main.pdf Technical Publications and Reports - https://nasa.sharepoint.com/sites/NASASTIProgram/SitePages/Glossary.aspx#t The name applied to a plant, animal, or other organism, according to the Codes of Nomenclature, consisting of a Genus and species. scientific name The name applied to a plant, animal, or other organism, according to the Codes of Nomenclature, consisting of a Genus and species. http://purl.obolibrary.org/obo/NCIT_C43459 TBD Currently not in NGLSDA. (Dan to review with John) photo gallery NCIt Definition: A regularly issued printed or electronic report describing a main topic of interest to its subscribers. newsletter document NCIt Definition: A regularly issued printed or electronic report describing a main topic of interest to its subscribers. NCI Metathesaurus (nih.gov) NCIt Definition: An established society, corporation, foundation or other organization founded and united for a specific purpose, e.g. for health-related research; also used to refer to a building or buildings occupied or used by such organization. CDISC Definition: An established society, corporation, foundation or other organization founded and united for a specific purpose, e.g. for health-related research; also used to refer to a building or buildings occupied or used by such organization. MGED Definition: A contacts affiliation, e.g. university, research institute or business. institution NCIt Definition: An established society, corporation, foundation or other organization founded and united for a specific purpose, e.g. for health-related research; also used to refer to a building or buildings occupied or used by such organization. CDISC Definition: An established society, corporation, foundation or other organization founded and united for a specific purpose, e.g. for health-related research; also used to refer to a building or buildings occupied or used by such organization. MGED Definition: A contacts affiliation, e.g. university, research institute or business. NCI Metathesaurus (nih.gov) A document that is about a mission. For LSDA, mission documents include mission personnel, operations, schedules, and other related documents. mission document A person responsible for the overall conduct of a study principal investigator (human) How long something or someone has existed; measured at launch/start age (at launch/start) Indicates the scientific area addressed by the study. This clas is maintained by NASA Life Sciences Data Archive. research area Any extent of continuous biological sequence. GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence. 2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology). 3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern). A sequence feature is an extent of 'located' biological sequence, whose identity is determined by both its inherent sequence (ordering of monomeric units) and its position (start and end coordinates based on alignment with some reference). By contrast, 'biological sequences' are identified and distinguished only by their inehrent sequence, and not their position. Accordingly, the 'ATG' start codon in the coding DNA sequence of the human AKT gene is the same 'sequence' as the 'ATG' start codon in the human SHH gene, but these represent two distinct 'sequence features' in virtue of their different positions in the genome. sequence_feature true Formalizes the first identity criteria for a sequence feature of its sequence. true Formalizes the second identify criteiria for a sequence feature of its genomic position. We use the FALDO model to represent positional information, which links features to positional information through an instance of a Region class that represents the mapping of the feature onto some reference sequence. (But features can also be linked to Positions directly through the location property). A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where 'genetic material' refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny) Genotype vs Genome in GENO: An (genomic) genotype is an information artifact representing a shorthand syntax for specifying what is known about variation in a genome sequence. This syntax has reference and variant components - a 'reference genome' and 'genomic variation complement' - that must be operated on to resolve a final genome sequence (i.e. substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the 'reference genome'). So, while the total sequence content represented in a genotype may be greater than that in a genome, the intended resolution of these sequences is to arrive at a single genome sequence. 'genome sequence' A genome is considered the complement of all heritable sequence features in a given cell or organism (chromosomal or extrachromosomal). This is typically a collection of >1 sequence molecules (e.g. chromosomes), but in some organisms (e.g. bacteria) it may be a single sequence macromolecule (e.g. a circular plasmid). For this reason 'genome' classifies under 'sequence feature complement'. genome Any organized collection of data in a computational format, defined by a theme or category that reflects what is being measured/observed/monitored. The presentation of the data in the application is enabled through metadata.REFERENCE. Research Data Alliance http://smw-rda.esc.rzg.mpg.de/index.php/Main_Page ; Mapping the Data Landscape 2011 Summit; TBS Standard on Geospatial Data (ISO 19115:2003); Environment Canada data stewardship &hellip; <a href=CASRAI. https://casrai.org/term/dataset/ class=more-link Peter McQuilton dataset Any organized collection of data in a computational format, defined by a theme or category that reflects what is being measured/observed/monitored. The presentation of the data in the application is enabled through metadata.REFERENCE. Research Data Alliance http://smw-rda.esc.rzg.mpg.de/index.php/Main_Page ; Mapping the Data Landscape 2011 Summit; TBS Standard on Geospatial Data (ISO 19115:2003); Environment Canada data stewardship &hellip; <a href=CASRAI. https://casrai.org/term/dataset/ class=more-link CASRAI. https://casrai.org/term/dataset/ material anatomical entity Anatomical entity that has mass. material anatomical entity anatomical cluster Anatomical group that has its parts adjacent to one another. Anatomical group whose component anatomical structures lie in close proximity to each other. anatomical cluster length unit A unit which is a standard measure of the distance between two points. length unit mass unit A unit which is a standard measure of the amount of matter/energy of a physical object. mass unit time unit A unit which is a standard measure of the dimension in which events occur in sequence. time derived unit time unit temperature unit temperature derived unit temperature unit substance unit substance unit concentration unit concentration unit volume unit volume unit frequency unit frequency unit volumetric flow rate unit volumetric flow rate unit rate unit rate unit The DCMI Type Vocabulary provides a general, cross-domain list of approved terms that may be used as values for the Resource Type element to identify the genre of a resource. 2000-07-11 2002-06-15 A list of types used to categorize the nature or genre of the content of the resource. DCMI Type Vocabulary 2000-07-11 A set of date encoding schemes and/or formats Date Encoding Schemes 2000-07-11 A set of format encoding schemes. Format Encoding Schemes 2000-07-11 A set of resource identifier encoding schemes and/or formats Resource Identifier Encoding Schemes 2000-07-11 A set of language encoding schemes and/or formats. Language Encoding Schemes 2000-07-11 A set of resource relation encoding schemes and/or formats Resource Relation Encoding Schemes 2000-07-11 A set of source encoding schemes and/or formats Source Encoding Schemes 2000-07-11 A set of geographic place encoding schemes and/or formats Place Encoding Schemes 2000-07-11 A set of subject encoding schemes and/or formats Subject Encoding Schemes 2000-07-11 A set of encoding schemes for the coverage qualifier "temporal" Encoding Schemes for temporal characteristics 2000-07-11 A set of resource type encoding schemes and/or formats Resource Type Encoding Schemes Computer software, or generally just software, is any set of machine-readable instructions (most often in the form of a computer program) that conform to a given syntax (sometimes referred to as a language) that is interpretable by a given processor and that directs a computer's processor to perform specific operations. James Malone Modified in parts from https://en.wikipedia.org/wiki/Software Robert Stevens AL 7.9.22: There are some reasoning oddities associated with marking IAO and SWO software as equivalent; once these are sorted out, the equivalence statement will take the place of this current parent-child relationship. software A licence is a legal instrument (usually by way of contract law, with or without printed material) governing the use or redistribution of the resource containing the licence. Modified from http://en.wikipedia.org/wiki/Software_license licence software license The mode of interaction with a piece of software. software interface A web service is a software interface which works as a method of communication between two electronic devices over the World Wide Web and which is provided at a particular network address. There are two major classes of Web services: REST-compliant Web services, and arbitrary (or application-specific) Web services. Web Service Modified from http://www.w3.org/TR/ws-arch/, accessed 6 June 2013; Modified from http://en.wikipedia.org/wiki/Web_service, accessed 6 June 2013. web service A Graphical user interface is a type of software interface that allows users to interact with electronic devices using images rather than text commands. A GUI represents the information and actions available to a user through graphical icons and visual indicators such as secondary notation, as opposed to text-based interfaces, typed command labels or text navigation. https://en.wikipedia.org/wiki/Graphical_user_interface, accessed 6 June 2013. GUI graphical user interface An application programming interface is a set of routines, protocols, and tools for building software applications. An API expresses a software component in terms of its operations, inputs, outputs, and underlying types. An API defines functionalities that are independent of their respective implementations, which allows definitions and implementations to vary without compromising each other. The API specifies how software components should interact. API http://en.wikipedia.org/wiki/Application_programming_interface, accessed 25 November 2014. application programming interface Acquaintance 1 1 1 1 1 To specify the components of the delivery address for the object Address Agent This class is deprecated BBS true This class is deprecated Car true Also called mobile telephone Cell Child Colleague Contact Coresident Coworker Crush Date This class is deprecated Dom true To specify the electronic mail address for communication with the object the vCard represents. Use the hasEmail object property. Email true Emergency Fax Female Friend Used for gender codes. The URI of the gender code must be used as the value for Gender. Gender 1 Object representing a group of persons or entities. A group object will usually contain hasMember properties to specify the members of the group. Group This implies that the property is related to an individual's personal life Home This class is deprecated ISDN true An object representing a single person or entity Individual This class is deprecated Internet true This class is deprecated Intl true Kin 1 The parent class for all objects Kind This class is deprecated Label true An object representing a named geographical place Location Male Me Met This class is deprecated Modem true This class is deprecated Msg true Muse 0 1 1 0 0 To specify the components of the name of the object Name Neighbor None An object representing an organization. An organization is a single entity, and might represent a business or government, a department or division within a business or government, a club, an association, or the like. Organization Other This class is deprecated PCS true Pager This class is deprecated Parcel true Parent This class is deprecated Postal true This class is deprecated Pref true Used for relation type codes. The URI of the relation type code must be used as the value for the Relation Type. Relation Type Sibling Spouse Sweetheart This class is deprecated. Use the hasTelephone object property. Tel true Used for telephone type codes. The URI of the telephone type code must be used as the value for the Telephone Type. Phone Also called sms telephone Text Text phone Used for type codes. The URI of the type code must be used as the value for Type. Type Unknown The vCard class is equivalent to the new Kind class, which is the parent for the four explicit types of vCards (Individual, Organization, Location, Group) VCard Video Voice This implies that the property is related to an individual's work place Work This class is deprecated X400 true A curated collection of metadata about resources (e.g., datasets and data services in the context of a data catalog). En udvalgt og arrangeret samling af metadata om ressourcer (fx datasæt og datatjenester i kontekst af et datakatalog). Una colección curada de metadatos sobre recursos (por ejemplo, conjuntos de datos y servicios de datos en el contexto de un catálogo de datos). Una raccolta curata di metadati sulle risorse (ad es. sui dataset e relativi servizi nel contesto di cataloghi di dati). Une collection élaborée de métadonnées sur les jeux de données Řízená kolekce metadat o datových sadách a datových službách Μια επιμελημένη συλλογή μεταδεδομένων περί συνόλων δεδομένων مجموعة من توصيفات قوائم البيانات データ・カタログは、データセットに関するキュレートされたメタデータの集合です。 Catalog Catalogo Catalogue Catálogo Katalog Katalog Κατάλογος فهرس قوائم البيانات カタログ A curated collection of metadata about resources (e.g., datasets and data services in the context of a data catalog). En samling af metadata om ressourcer (fx datasæt og datatjenester i kontekst af et datakatalog). Una colección curada de metadatos sobre recursos (por ejemplo, conjuntos de datos y servicios de datos en el contexto de un catálogo de datos). Una raccolta curata di metadati sulle risorse (ad es. sui dataset e relativi servizi nel contesto di cataloghi di dati). Une collection élaborée de métadonnées sur les jeux de données. Řízená kolekce metadat o datových sadách a datových službách. Μια επιμελημένη συλλογή μεταδεδομένων περί συνόλων δεδομένων. مجموعة من توصيفات قوائم البيانات データ・カタログは、データセットに関するキュレートされたメタデータの集合です。 English, Italian, Spanish definitions updated in this revision. Multilingual text not yet updated. A web-based data catalog is typically represented as a single instance of this class. Et webbaseret datakatalog repræsenteres typisk ved en enkelt instans af denne klasse. Normalmente, un catalogo di dati nel web viene rappresentato come una singola istanza di questa classe. Normalmente, un catálogo de datos disponible en la web se representa como una única instancia de esta clase. Webový datový katalog je typicky reprezentován jako jedna instance této třídy. Συνήθως, ένας κατάλογος δεδομένων στον Παγκόσμιο Ιστό αναπαρίσταται ως ένα στιγμιότυπο αυτής της κλάσης. 通常、ウェブ・ベースのデータ・カタログは、このクラスの1つのインスタンスとして表わされます。 1 1つのデータセットを記述したデータ・カタログ内のレコード。 A record in a data catalog, describing the registration of a single dataset or data service. En post i et datakatalog der beskriver registreringen af et enkelt datasæt eller en datatjeneste. Un record in un catalogo di dati che descrive un singolo dataset o servizio di dati. Un registre du catalogue ou une entrée du catalogue, décrivant un seul jeu de données. Un registro en un catálogo de datos que describe un solo conjunto de datos o un servicio de datos. Záznam v datovém katalogu popisující jednu datovou sadu či datovou službu. Μία καταγραφή ενός καταλόγου, η οποία περιγράφει ένα συγκεκριμένο σύνολο δεδομένων. Catalog Record Katalogizační záznam Katalogpost Record di catalogo Registre du catalogue Registro del catálogo Καταγραφή καταλόγου سجل カタログ・レコード 1つのデータセットを記述したデータ・カタログ内のレコード。 A record in a data catalog, describing the registration of a single dataset or data service. En post i et datakatalog der beskriver registreringen af et enkelt datasæt eller en datatjeneste. Un record in un catalogo di dati che descrive un singolo dataset o servizio di dati. Un registre du catalogue ou une entrée du catalogue, décrivant un seul jeu de données. Un registro en un catálogo de datos que describe un solo conjunto de datos o un servicio de datos. Záznam v datovém katalogu popisující jednu datovou sadu či datovou službu. Μία καταγραφή ενός καταλόγου, η οποία περιγράφει ένα συγκεκριμένο σύνολο δεδομένων. English definition updated in this revision. Multilingual text not yet updated except the Spanish one and the Czech one and Italian one. C'est une classe facultative et tous les catalogues ne l'utiliseront pas. Cette classe existe pour les catalogues ayant une distinction entre les métadonnées sur le jeu de données et les métadonnées sur une entrée du jeu de données dans le catalogue. Denne klasse er valgfri og ikke alle kataloger vil anvende denne klasse. Den kan anvendes i de kataloger hvor der skelnes mellem metadata om datasættet eller datatjenesten og metadata om selve posten til registreringen af datasættet eller datatjenesten i kataloget. Udgivelsesdatoen for datasættet afspejler for eksempel den dato hvor informationerne oprindeligt blev gjort tilgængelige af udgiveren, hvorimod udgivelsesdatoen for katalogposten er den dato hvor datasættet blev føjet til kataloget. I de tilfælde hvor de to datoer er forskellige eller hvor blot sidstnævnte er kendt, bør udgivelsesdatoen kun angives for katalogposten. Bemærk at W3Cs PROV ontologi gør til muligt at tilføje yderligere proveniensoplysninger eksempelvis om processen eller aktøren involveret i en given ændring af datasættet. Esta clase es opcional y no todos los catálogos la utilizarán. Esta clase existe para catálogos que hacen una distinción entre los metadatos acerca de un conjunto de datos o un servicio de datos y los metadatos acerca de una entrada en ese conjunto de datos en el catálogo. Por ejemplo, la propiedad sobre la fecha de la publicación de los datos refleja la fecha en que la información fue originalmente publicada, mientras que la fecha de publicación del registro del catálogo es la fecha en que los datos se agregaron al mismo. En caso en que ambas fechas fueran diferentes, o en que sólo la fecha de publicación del registro del catálogo estuviera disponible, sólo debe especificarse en el registro del catálogo. Tengan en cuenta que la ontología PROV de W3C permite describir otra información sobre la proveniencia de los datos, como por ejemplo detalles del proceso y de los agentes involucrados en algún cambio específico a los datos. Questa classe è opzionale e non tutti i cataloghi la utilizzeranno. Esiste per cataloghi in cui si opera una distinzione tra i metadati relativi al dataset ed i metadati relativi alla gestione del dataset nel catalogo. Ad esempio, la proprietà per indicare la data di pubblicazione del dataset rifletterà la data in cui l'informazione è stata originariamente messa a disposizione dalla casa editrice, mentre la data di pubblicazione per il record nel catalogo rifletterà la data in cui il dataset è stato aggiunto al catalogo. Nei casi dove solo quest'ultima sia nota, si utilizzerà esclusivamente la data di pubblicazione relativa al record del catalogo. Si noti che l'Ontologia W3C PROV permette di descrivere ulteriori informazioni sulla provenienza, quali i dettagli del processo, la procedura e l'agente coinvolto in una particolare modifica di un dataset. Tato třída je volitelná a ne všechny katalogy ji využijí. Existuje pro katalogy, ve kterých se rozlišují metadata datové sady či datové služby a metadata o záznamu o datové sadě či datové službě v katalogu. Například datum publikace datové sady odráží datum, kdy byla datová sada původně zveřejněna poskytovatelem dat, zatímco datum publikace katalogizačního záznamu je datum zanesení datové sady do katalogu. V případech kdy se obě data liší, nebo je známo jen to druhé, by mělo být specifikováno jen datum publikace katalogizačního záznamu. Všimněte si, že ontologie W3C PROV umožňuje popsat další informace o původu jako například podrobnosti o procesu konkrétní změny datové sady a jeho účastnících. This class is optional and not all catalogs will use it. It exists for catalogs where a distinction is made between metadata about a dataset or data service and metadata about the entry for the dataset or data service in the catalog. For example, the publication date property of the dataset reflects the date when the information was originally made available by the publishing agency, while the publication date of the catalog record is the date when the dataset was added to the catalog. In cases where both dates differ, or where only the latter is known, the publication date should only be specified for the catalog record. Notice that the W3C PROV Ontology allows describing further provenance information such as the details of the process and the agent involved in a particular change to a dataset. Αυτή η κλάση είναι προαιρετική και δεν χρησιμοποιείται από όλους τους καταλόγους. Υπάρχει για τις περιπτώσεις καταλόγων όπου γίνεται διαχωρισμός μεταξύ των μεταδεδομένων για το σύνολο των δεδομένων και των μεταδεδομένων για την καταγραφή του συνόλου δεδομένων εντός του καταλόγου. Για παράδειγμα, η ιδιότητα της ημερομηνίας δημοσίευσης του συνόλου δεδομένων δείχνει την ημερομηνία κατά την οποία οι πληροφορίες έγιναν διαθέσιμες από τον φορέα δημοσίευσης, ενώ η ημερομηνία δημοσίευσης της καταγραφής του καταλόγου δείχνει την ημερομηνία που το σύνολο δεδομένων προστέθηκε στον κατάλογο. Σε περιπτώσεις που οι δύο ημερομηνίες διαφέρουν, ή που μόνο η τελευταία είναι γνωστή, η ημερομηνία δημοσίευσης θα πρέπει να δίνεται για την καταγραφή του καταλόγου. Να σημειωθεί πως η οντολογία W3C PROV επιτρέπει την περιγραφή επιπλέον πληροφοριών ιστορικού όπως λεπτομέρειες για τη διαδικασία και τον δράστη που εμπλέκονται σε μία συγκεκριμένη αλλαγή εντός του συνόλου δεδομένων. このクラスはオプションで、すべてのカタログがそれを用いるとは限りません。これは、データセットに関するメタデータとカタログ内のデータセットのエントリーに関するメタデータとで区別が行われるカタログのために存在しています。例えば、データセットの公開日プロパティーは、公開機関が情報を最初に利用可能とした日付を示しますが、カタログ・レコードの公開日は、データセットがカタログに追加された日付です。両方の日付が異っていたり、後者だけが分かっている場合は、カタログ・レコードに対してのみ公開日を指定すべきです。W3CのPROVオントロジー[prov-o]を用いれば、データセットに対する特定の変更に関連するプロセスやエージェントの詳細などの、さらに詳しい来歴情報の記述が可能となることに注意してください。 A site or end-point providing operations related to the discovery of, access to, or processing functions on, data or related resources. Et websted eller endpoint der udstiller operationer relateret til opdagelse af, adgang til eller behandlende funktioner på data eller relaterede ressourcer. Umístění či přístupový bod poskytující operace související s hledáním, přistupem k, či výkonem funkcí na datech či souvisejících zdrojích. Un sitio o end-point que provee operaciones relacionadas a funciones de descubrimiento, acceso, o procesamiento de datos o recursos relacionados. Un sito o end-point che fornisce operazioni relative alla scoperta, all'accesso o all'elaborazione di funzioni su dati o risorse correlate. Data service Datatjeneste Servicio de datos Servizio di dati Dataservice New class added in DCAT 2.0. Nová třída přidaná ve verzi DCAT 2.0. Nueva clase añadida en DCAT 2.0. Nuova classe aggiunta in DCAT 2.0. Ny klasse tilføjet i DCAT 2.0. A site or end-point providing operations related to the discovery of, access to, or processing functions on, data or related resources. Et site eller endpoint der udstiller operationer relateret til opdagelse af, adgang til eller behandlende funktioner på data eller relaterede ressourcer. Umístění či přístupový bod poskytující operace související s hledáním, přistupem k, či výkonem funkcí na datech či souvisejících zdrojích. Un sitio o end-point que provee operaciones relacionadas a funciones de descubrimiento, acceso, o procesamiento de datos o recursos relacionados. Un sito o end-point che fornisce operazioni relative alla scoperta, all'accesso o all'elaborazione di funzioni su dati o risorse correlate. Datatjenestetypen kan indikeres ved hjælp af egenskaben dct:type. Værdien kan tages fra kontrollerede udfaldsrum såsom INSPIRE spatial data service vocabulary. Druh služby může být indikován vlastností dct:type. Její hodnota může být z řízeného slovníku, kterým je například slovník typů prostorových datových služeb INSPIRE. El tipo de servicio puede indicarse usando la propiedad dct:type. Su valor puede provenir de un vocabulario controlado, como por ejemplo el vocabulario de servicios de datos espaciales de INSPIRE. Hvis en dcat:DataService er bundet til en eller flere specifikke datasæt kan dette indikeres ved hjælp af egenskaben dcat:servesDataset. If a dcat:DataService is bound to one or more specified Datasets, they are indicated by the dcat:servesDataset property. Il tipo di servizio può essere indicato usando la proprietà dct:type. Il suo valore può essere preso da un vocabolario controllato come il vocabolario dei tipi di servizi per dati spaziali di INSPIRE. Pokud je dcat:DataService navázána na jednu či více Datových sad, jsou tyto indikovány vlstností dcat:servesDataset. Se un dcat:DataService è associato a uno o più Dataset specificati, questi sono indicati dalla proprietà dcat:serveDataset. Si un dcat:DataService está asociado con uno o más conjuntos de datos especificados, dichos conjuntos de datos pueden indicarse con la propiedad dcat:servesDataset. The kind of service can be indicated using the dct:type property. Its value may be taken from a controlled vocabulary such as the INSPIRE spatial data service type vocabulary. 1つのエージェントによって公開またはキュレートされ、1つ以上の形式でアクセスまたはダウンロードできるデータの集合。 A collection of data, published or curated by a single source, and available for access or download in one or more representations. En samling af data, udgivet eller udvalgt og arrangeret af en enkelt kilde og som er til råde for adgang til eller download af i en eller flere repræsentationer. Kolekce dat poskytovaná či řízená jedním zdrojem, která je k dispozici pro přístup či stažení v jednom či více formátech. Raccolta di dati, pubblicati o curati da un'unica fonte, disponibili per l'accesso o il download in uno o più formati. Una colección de datos, publicados o conservados por una única fuente, y disponibles para ser accedidos o descargados en uno o más formatos. Une collection de données, publiée ou élaborée par une seule source, et disponible pour accès ou téléchargement dans un ou plusieurs formats. Μία συλλογή από δεδομένα, δημοσιευμένη ή επιμελημένη από μία και μόνο πηγή, διαθέσιμη δε προς πρόσβαση ή μεταφόρτωση σε μία ή περισσότερες μορφές. قائمة بيانات منشورة أو مجموعة من قبل مصدر ما و متاح الوصول إليها أو تحميلها Conjunto de datos Dataset Dataset Datasæt Datová sada Jeu de données Σύνολο Δεδομένων قائمة بيانات データセット Datasamling 2018-02 - odstraněno tvrzení o podtřídě dctype:Dataset, jelikož rozsah dcat:Dataset zahrnuje několik dalších typů ze slovníku dctype. 2018-02 - se eliminó el axioma de subclase con dctype:Dataset porque el alcance de dcat:Dataset incluye muchos otros tipos del vocabulario dctype. 2018-02 - sottoclasse di dctype:Dataset rimosso perché l'ambito di dcat:Dataset include diversi altri tipi dal vocabolario dctype. 2018-02 - subclass of dctype:Dataset removed because scope of dcat:Dataset includes several other types from the dctype vocabulary. 2018-02 - subklasse af dctype:Dataset fjernet da scope af dcat:Dataset omfatter flere forskellige typer fra dctype-vokabularet. 1つのエージェントによって公開またはキュレートされ、1つ以上の形式でアクセスまたはダウンロードできるデータの集合。 A collection of data, published or curated by a single source, and available for access or download in one or more represenations. En samling a data, udgivet eller udvalgt og arrangeret af en enkelt kilde og som der er adgang til i en eller flere repræsentationer. Kolekce dat poskytovaná či řízená jedním zdrojem, která je k dispozici pro přístup či stažení v jednom či více formátech. Raccolta di dati, pubblicati o curati da un'unica fonte, disponibili per l'accesso o il download in uno o più formati. Una colección de datos, publicados o conservados por una única fuente, y disponibles para ser accedidos o descargados en uno o más formatos. Une collection de données, publiée ou élaborée par une seule source, et disponible pour accès ou téléchargement dans un ou plusieurs formats. Μία συλλογή από δεδομένα, δημοσιευμένη ή επιμελημένη από μία και μόνο πηγή, διαθέσιμη δε προς πρόσβαση ή μεταφόρτωση σε μία ή περισσότερες μορφές. قائمة بيانات منشورة أو مجموعة من قبل مصدر ما و متاح الوصول إليها أو تحميلها 2020-03-16 A new scopenote added and need to be translated Cette classe représente le jeu de données publié par le fournisseur de données. Dans les cas où une distinction est nécessaire entre le jeu de donénes et son entrée dans le catalogue, la classe registre de données peut être utilisée pour ce dernier. Denne klasse beskriver det konceptuelle datasæt. En eller flere repræsentationer kan være tilgængelige med forskellige skematiske opsætninger, formater eller serialiseringer. Denne klasse repræsenterer det konkrete datasæt som det udgives af datasætleverandøren. I de tilfælde hvor det er nødvendigt at skelne mellem det konkrete datasæt og dets registrering i kataloget (fordi metadata såsom ændringsdato og vedligeholder er forskellige), så kan klassen katalogpost anvendes. Esta clase representa el conjunto de datos publicados. En los casos donde es necesario distinguir entre el conjunto de datos y su entrada en el catálogo de datos, se debe utilizar la clase 'registro del catálogo'. Questa classe descrive il dataset dal punto di vista concettuale. Possono essere disponibili una o più rappresentazioni, con diversi layout e formati schematici o serializzazioni. Questa classe rappresenta il dataset come pubblicato dall’editore. Nel caso in cui sia necessario operare una distinzione fra i metadati originali del dataset e il record dei metadati ad esso associato nel catalogo (ad esempio, per distinguere la data di modifica del dataset da quella del dataset nel catalogo) si può impiegare la classe catalog record. Tato třída reprezentuje datovou sadu tak, jak je publikována poskytovatelem dat. V případě potřeby rozlišení datové sady a jejího katalogizačního záznamu (jelikož metadata jako datum modifikace se mohou lišit) pro něj může být použita třída "katalogizační záznam". The notion of dataset in DCAT is broad and inclusive, with the intention of accommodating resource types arising from all communities. Data comes in many forms including numbers, text, pixels, imagery, sound and other multi-media, and potentially other types, any of which might be collected into a dataset. This class describes the conceptual dataset. One or more representations might be available, with differing schematic layouts and formats or serializations. This class represents the actual dataset as published by the dataset provider. In cases where a distinction between the actual dataset and its entry in the catalog is necessary (because metadata such as modification date and maintainer might differ), the catalog record class can be used for the latter. Η κλάση αυτή αναπαριστά το σύνολο δεδομένων αυτό καθ'εαυτό, όπως έχει δημοσιευθεί από τον εκδότη. Σε περιπτώσεις όπου είναι απαραίτητος ο διαχωρισμός μεταξύ του συνόλου δεδομένων και της καταγραφής αυτού στον κατάλογο (γιατί μεταδεδομένα όπως η ημερομηνία αλλαγής και ο συντηρητής μπορεί να διαφέρουν) η κλάση της καταγραφής καταλόγου μπορεί να χρησιμοποιηθεί για το τελευταίο. このクラスは、データセットの公開者が公開する実際のデータセットを表わします。カタログ内の実際のデータセットとそのエントリーとの区別が必要な場合（修正日と維持者などのメタデータが異なるかもしれないので）は、後者にcatalog recordというクラスを使用できます。 A specific representation of a dataset. A dataset might be available in multiple serializations that may differ in various ways, including natural language, media-type or format, schematic organization, temporal and spatial resolution, level of detail or profiles (which might specify any or all of the above). En specifik repræsentation af et datasæt. Et datasæt kan være tilgængelig i mange serialiseringer der kan variere på forskellige vis, herunder sprog, medietype eller format, systemorganisering, tidslig- og geografisk opløsning, detaljeringsniveau eller profiler (der kan specificere en eller flere af ovenstående). Konkrétní reprezentace datové sady. Datová sada může být dostupná v různých serializacích, které se mohou navzájem lišit různými způsoby, mimo jiné přirozeným jazykem, media-typem či formátem, schematickou organizací, časovým a prostorovým rozlišením, úrovní detailu či profily (které mohou specifikovat některé či všechny tyto rozdíly). Rappresenta una forma disponibile e specifica del dataset. Ciascun dataset può essere disponibile in forme differenti, che possono rappresentare formati diversi o diversi punti di accesso per un dataset. Esempi di distribuzioni sono un file CSV scaricabile, una API o un RSS feed. Représente une forme spécifique d'un jeu de données. Caque jeu de données peut être disponible sous différentes formes, celles-ci pouvant représenter différents formats du jeu de données ou différents endpoint. Des exemples de distribution sont des fichirs CSV, des API ou des flux RSS. Una representación específica de los datos. Cada conjunto de datos puede estar disponible en formas diferentes, las cuáles pueden variar en distintas formas, incluyendo el idioma, 'media-type' o formato, organización esquemática, resolución temporal y espacial, nivel de detalle o perfiles (que pueden especificar cualquiera o todas las diferencias anteriores). Αναπαριστά μία συγκεκριμένη διαθέσιμη μορφή ενός συνόλου δεδομένων. Κάθε σύνολο δεδομενων μπορεί να είναι διαθέσιμο σε διαφορετικές μορφές, οι μορφές αυτές μπορεί να αναπαριστούν διαφορετικές μορφές αρχείων ή διαφορετικά σημεία διάθεσης. Παραδείγματα διανομών συμπεριλαμβάνουν ένα μεταφορτώσιμο αρχείο μορφής CSV, ένα API ή ένα RSS feed. شكل محدد لقائمة البيانات يمكن الوصول إليه. قائمة بيانات ما يمكن أن تكون متاحه باشكال و أنواع متعددة. ملف يمكن تحميله أو واجهة برمجية يمكن من خلالها الوصول إلى البيانات هي أمثلة على ذلك. データセットの特定の利用可能な形式を表わします。各データセットは、異なる形式で利用できることがあり、これらの形式は、データセットの異なる形式や、異なるエンドポイントを表わす可能性があります。配信の例には、ダウンロード可能なCSVファイル、API、RSSフィードが含まれます。 Distribuce Distribución Distribution Distribution Distribution Distribuzione Διανομή التوزيع 配信 Datadistribution Datamanifestation Datarepræsentation Dataudstilling A specific representation of a dataset. A dataset might be available in multiple serializations that may differ in various ways, including natural language, media-type or format, schematic organization, temporal and spatial resolution, level of detail or profiles (which might specify any or all of the above). En specifik repræsentation af et datasæt. Et datasæt kan være tilgængelig i mange serialiseringer der kan variere på forskellige vis, herunder sprog, medietype eller format, systemorganisering, tidslig- og geografisk opløsning, detaljeringsniveau eller profiler (der kan specificere en eller flere af ovenstående). Konkrétní reprezentace datové sady. Datová sada může být dostupná v různých serializacích, které se mohou navzájem lišit různými způsoby, mimo jiné přirozeným jazykem, media-typem či formátem, schematickou organizací, časovým a prostorovým rozlišením, úrovní detailu či profily (které mohou specifikovat některé či všechny tyto rozdíly). Rappresenta una forma disponibile e specifica del dataset. Ciascun dataset può essere disponibile in forme differenti, che possono rappresentare formati diversi o diversi punti di accesso per un dataset. Esempi di distribuzioni sono un file CSV scaricabile, una API o un RSS feed. Représente une forme spécifique d'un jeu de données. Caque jeu de données peut être disponible sous différentes formes, celles-ci pouvant représenter différents formats du jeu de données ou différents endpoint. Des exemples de distribution sont des fichirs CSV, des API ou des flux RSS. Una representación específica de los datos. Cada conjunto de datos puede estar disponible en formas diferentes, las cuáles pueden variar en distintas formas, incluyendo el idioma, 'media-type' o formato, organización esquemática, resolución temporal y espacial, nivel de detalle o perfiles (que pueden especificar cualquiera o todas las diferencias anteriores). Αναπαριστά μία συγκεκριμένη διαθέσιμη μορφή ενός συνόλου δεδομένων. Κάθε σύνολο δεδομενων μπορεί να είναι διαθέσιμο σε διαφορετικές μορφές, οι μορφές αυτές μπορεί να αναπαριστούν διαφορετικές μορφές αρχείων ή διαφορετικά σημεία διάθεσης. Παραδείγματα διανομών συμπεριλαμβάνουν ένα μεταφορτώσιμο αρχείο μορφής CSV, ένα API ή ένα RSS feed. شكل محدد لقائمة البيانات يمكن الوصول إليه. قائمة بيانات ما يمكن أن تكون متاحه باشكال و أنواع متعددة. ملف يمكن تحميله أو واجهة برمجية يمكن من خلالها الوصول إلى البيانات هي أمثلة على ذلك. データセットの特定の利用可能な形式を表わします。各データセットは、異なる形式で利用できることがあり、これらの形式は、データセットの異なる形式や、異なるエンドポイントを表わす可能性があります。配信の例には、ダウンロード可能なCSVファイル、API、RSSフィードが含まれます。 Ceci représente une disponibilité générale du jeu de données, et implique qu'il n'existe pas d'information sur la méthode d'accès réelle des données, par exple, si c'est un lien de téléchargement direct ou à travers une page Web. Denne klasse repræsenterer datasættets overordnede tilgængelighed og giver ikke oplysninger om hvilken metode der kan anvendes til at få adgang til data, dvs. om adgang til datasættet realiseres ved direkte download, API eller via et websted. Anvendelsen af egenskaben dcat:downloadURL indikerer at distributionen kan downloades direkte. Esta clase representa una disponibilidad general de un conjunto de datos, e implica que no existe información acerca del método de acceso real a los datos, i.e., si es un enlace de descarga directa o a través de una página Web. Questa classe rappresenta una disponibilità generale di un dataset e non implica alcuna informazione sul metodo di accesso effettivo ai dati, ad esempio se si tratta di un accesso a download diretto, API, o attraverso una pagina Web. L'utilizzo della proprietà dcat:downloadURL indica distribuzioni direttamente scaricabili. This represents a general availability of a dataset it implies no information about the actual access method of the data, i.e. whether by direct download, API, or through a Web page. The use of dcat:downloadURL property indicates directly downloadable distributions. Toto popisuje obecnou dostupnost datové sady. Neimplikuje žádnou informaci o skutečné metodě přístupu k datům, tj. zda jsou přímo ke stažení, skrze API či přes webovou stránku. Použití vlastnosti dcat:downloadURL indikuje přímo stažitelné distribuce. Αυτό αναπαριστά μία γενική διαθεσιμότητα ενός συνόλου δεδομένων και δεν υπονοεί τίποτα περί του πραγματικού τρόπου πρόσβασης στα δεδομένα, αν είναι άμεσα μεταφορτώσιμα, μέσω API ή μέσω μίας ιστοσελίδας. Η χρήση της ιδιότητας dcat:downloadURL δείχνει μόνο άμεσα μεταφορτώσιμες διανομές. これは、データセットの一般的な利用可能性を表わし、データの実際のアクセス方式に関する情報（つまり、直接ダウンロードなのか、APIなのか、ウェブページを介したものなのか）を意味しません。dcat:downloadURLプロパティーの使用は、直接ダウンロード可能な配信を意味します。 An association class for attaching additional information to a relationship between DCAT Resources. Asociační třída pro připojení dodatečných informací ke vztahu mezi zdroji DCAT. En associationsklasse til brug for tilknytning af yderligere information til en relation mellem DCAT-ressourcer. Una clase de asociación para adjuntar información adicional a una relación entre recursos DCAT. Una classe di associazione per il collegamento di informazioni aggiuntive a una relazione tra le risorse DCAT. Relación Relation Relationship Relazione Vztah New class added in DCAT 2.0. Nová třída přidaná ve verzi DCAT 2.0. Nueva clase añadida en DCAT 2.0. Nuova classe aggiunta in DCAT 2.0. Ny klasse i DCAT 2.0. An association class for attaching additional information to a relationship between DCAT Resources. Asociační třída pro připojení dodatečných informací ke vztahu mezi zdroji DCAT. En associationsklasse til brug for tilknytning af yderligere information til en relation mellem DCAT-ressourcer. Una clase de asociación para adjuntar información adicional a una relación entre recursos DCAT. Una classe di associazione per il collegamento di informazioni aggiuntive a una relazione tra le risorse DCAT. Anvendes til at karakterisere en relation mellem datasæt, og potentielt andre ressourcer, hvor relationen er kendt men ikke tilstrækkeligt beskrevet af de standardiserede egenskaber i Dublin Core (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) eller PROV-O-egenskaber (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Používá se pro charakterizaci vztahu mezi datovými sadami a případně i jinými zdroji, kde druh vztahu je sice znám, ale není přiměřeně charakterizován standardními vlastnostmi slovníku Dublin Core (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) či vlastnostmi slovníku PROV-O (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Se usa para caracterizar la relación entre conjuntos de datos, y potencialmente otros recursos, donde la naturaleza de la relación se conoce pero no está caracterizada adecuadamente con propiedades del estándar 'Dublin Core' (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) or PROV-O properties (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Use to characterize a relationship between datasets, and potentially other resources, where the nature of the relationship is known but is not adequately characterized by the standard Dublin Core properties (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:requires, dct:isRequiredBy) or PROV-O properties (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov:hadPrimarySource, prov:alternateOf, prov:specializationOf). Viene utilizzato per caratterizzare la relazione tra insiemi di dati, e potenzialmente altri tipi di risorse, nei casi in cui la natura della relazione è nota ma non adeguatamente caratterizzata dalle proprietà dello standard 'Dublin Core' (dct:hasPart, dct:isPartOf, dct:conformsTo, dct:isFormatOf, dct:hasFormat, dct:isVersionOf, dct:hasVersion, dct:replaces, dct:isReplacedBy, dct:references, dct:isReferencedBy, dct:require, dct:isRequiredBy) o dalle propietà fornite da PROV-O (prov:wasDerivedFrom, prov:wasInfluencedBy, prov:wasQuotedFrom, prov:wasRevisionOf, prov: hadPrimarySource, prov:alternateOf, prov:specializationOf). Recurso publicado o curado por un agente único. Resource published or curated by a single agent. Ressource udgivet eller udvalgt og arrangeret af en enkelt aktør. Risorsa pubblicata o curata da un singolo agente. Zdroj publikovaný či řízený jediným činitelem. Catalogued resource Katalogiseret ressource Katalogizovaný zdroj Recurso catalogado Risorsa catalogata New class added in DCAT 2.0. Nová třída přidaná ve verzi DCAT 2.0. Nueva clase agregada en DCAT 2.0. Nuova classe aggiunta in DCAT 2.0. Ny klasse i DCAT 2.0. Recurso publicado o curado por un agente único. Resource published or curated by a single agent. Ressource udgivet eller udvalgt og arrangeret af en enkelt aktør. Risorsa pubblicata o curata da un singolo agente. Zdroj publikovaný či řízený jediným činitelem. Klassen for alle katalogiserede ressourcer, den overordnede klasse for dcat:Dataset, dcat:DataService, dcat:Catalog og enhvert medlem af et dcat:Catalog. Denne klasse bærer egenskaber der gælder alle katalogiserede ressourcer, herunder dataset og datatjenester. Det anbefales kraftigt at mere specifikke subklasser oprettes. Når der beskrives ressourcer der ikke er dcat:Dataset eller dcat:DataService, anbefales det at oprette passende subklasser af dcat:Resource eller at dcat:Resource anvendes sammen med egenskaben dct:type til opmærkning med en specifik typeangivelse. La clase de todos los recursos catalogados, la superclase de dcat:Dataset, dcat:DataService, dcat:Catalog y cualquier otro miembro de un dcat:Catalog. Esta clase tiene propiedades comunes a todos los recursos catalogados, incluyendo conjuntos de datos y servicios de datos. Se recomienda fuertemente que se use una clase más específica. Cuando se describe un recurso que no es un dcat:Dataset o dcat:DataService, se recomienda crear una sub-clase apropiada de dcat:Resource, o usar dcat:Resource con la propiedad dct:type to indicar el tipo específico. La classe di tutte le risorse catalogate, la Superclasse di dcat:Dataset, dcat:DataService, dcat:Catalog e qualsiasi altro membro di dcat:Catalog. Questa classe porta proprietà comuni a tutte le risorse catalogate, inclusi set di dati e servizi dati. Si raccomanda vivamente di utilizzare una sottoclasse più specifica. Quando si descrive una risorsa che non è un dcat:Dataset o dcat:DataService, si raccomanda di creare una sottoclasse di dcat:Resource appropriata, o utilizzare dcat:Resource con la proprietà dct:type per indicare il tipo specifico. The class of all catalogued resources, the Superclass of dcat:Dataset, dcat:DataService, dcat:Catalog and any other member of a dcat:Catalog. This class carries properties common to all catalogued resources, including datasets and data services. It is strongly recommended to use a more specific sub-class. When describing a resource which is not a dcat:Dataset or dcat:DataService, it is recommended to create a suitable sub-class of dcat:Resource, or use dcat:Resource with the dct:type property to indicate the specific type. Třída všech katalogizovaných zdrojů, nadtřída dcat:Dataset, dcat:DataService, dcat:Catalog a všech ostatních členů dcat:Catalog. Tato třída nese vlastnosti společné všem katalogizovaným zdrojům včetně datových sad a datových služeb. Je silně doporučeno používat specifičtější podtřídy, pokud je to možné. Při popisu zdroje, který není ani dcat:Dataset, ani dcat:DataService se doporučuje vytvořit odpovídající podtřídu dcat:Resrouce a nebo použít dcat:Resource s vlastností dct:type pro určení konkrétního typu. dcat:Resource er et udvidelsespunkt der tillader oprettelsen af enhver type af kataloger. Yderligere subklasser kan defineres i en DCAT-profil eller i en applikation til kataloger med andre typer af ressourcer. dcat:Resource es un punto de extensión que permite la definición de cualquier tipo de catálogo. Se pueden definir subclases adicionales en perfil de DCAT o una aplicación para catálogos de otro tipo de recursos. dcat:Resource is an extension point that enables the definition of any kind of catalog. Additional subclasses may be defined in a DCAT profile or application for catalogs of other kinds of resources. dcat:Resource je bod pro rozšíření umožňující definici různých druhů katalogů. Další podtřídy lze definovat v profilech DCAT či aplikacích pro katalogy zdrojů jiných druhů. dcat:Resource è un punto di estensione che consente la definizione di qualsiasi tipo di catalogo. Sottoclassi aggiuntive possono essere definite in un profilo DCAT o in un'applicazione per cataloghi di altri tipi di risorse. A role is the function of a resource or agent with respect to another resource, in the context of resource attribution or resource relationships. En rolle er den funktion en ressource eller aktør har i forhold til en anden ressource, i forbindelse med ressourcekreditering eller ressourcerelationer. Role je funkce zdroje či agenta ve vztahu k jinému zdroji, v kontextu přiřazení zdrojů či vztahů mezi zdroji. Un rol es la función de un recurso o agente con respecto a otro recuros, en el contexto de atribución del recurso o de las relaciones entre recursos. Un ruolo è la funzione di una risorsa o di un agente rispetto ad un'altra risorsa, nel contesto dell'attribuzione delle risorse o delle relazioni tra risorse. Rol Role Role Rolle Ruolo New class added in DCAT 2.0. Nová třída přidaná ve verzi DCAT 2.0. Nueva clase agregada en DCAT 2.0. Nuova classe aggiunta in DCAT 2.0. Ny klasse tilføjet i DCAT 2.0. A role is the function of a resource or agent with respect to another resource, in the context of resource attribution or resource relationships. En rolle er den funktion en ressource eller aktør har i forhold til en anden ressource, i forbindelse med ressourcekreditering eller ressourcerelationer. Role je funkce zdroje či agenta ve vztahu k jinému zdroji, v kontextu přiřazení zdrojů či vztahů mezi zdroji. Un rol es la función de un recurso o agente con respecto a otro recuros, en el contexto de atribución del recurso o de las relaciones entre recursos. Un ruolo è la funzione di una risorsa o di un agente rispetto ad un'altra risorsa, nel contesto dell'attribuzione delle risorse o delle relazioni tra risorse. Incluída en DCAT para complementar prov:Role (cuyo uso está limitado a roles en el contexto de una actividad, ya que es el rango es prov:hadRole). Introdotta in DCAT per completare prov:Role (il cui uso è limitato ai ruoli nel contesto di un'attività, in conseguenza alla definizione del codominio di prov:hadRole). Introduced into DCAT to complement prov:Role (whose use is limited to roles in the context of an activity, as the range of prov:hadRole). Introduceret i DCAT for at supplere prov:Role (hvis anvendelse er begrænset til roller i forbindelse med en aktivitet, som er rækkevidde for prov:hadRole). Přidáno do DCAT pro doplnění třídy prov:Role (jejíž užití je omezeno na role v kontextu aktivit, jakožto obor hodnot vlastnosti prov:hadRole). Anvendes i forbindelse med kvalificerede krediteringer til at angive aktørens rolle i forhold til en entitet. Det anbefales at værdierne styres som et kontrolleret udfaldsrum med aktørroller, såsom http://registry.it.csiro.au/def/isotc211/CI_RoleCode. Anvendes i forbindelse med kvalificerede relationer til at specificere en entitets rolle i forhold til en anden entitet. Det anbefales at værdierne styres med et kontrolleret udfaldsrum for for entitetsroller såsom: ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode; IANA Registry of Link Relations https://www.iana.org/assignments/link-relation; DataCite metadata schema; MARC relators https://id.loc.gov/vocabulary/relators. Použito v kvalifikovaném přiřazení pro specifikaci role Agenta ve vztahu k Entitě. Je doporučeno množinu hodnot spravovat jako řízený slovník rolí agentů, jako například http://registry.it.csiro.au/def/isotc211/CI_RoleCode. Použito v kvalifikovaném vztahu pro specifikaci role Entity ve vztahu k jiné Entitě. Je doporučeno množinu hodnot spravovat jako řízený slovník rolí entit, jako například ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode, IANA Registry of Link Relations https://www.iana.org/assignments/link-relation, DataCite metadata schema, či MARC relators https://id.loc.gov/vocabulary/relators. Se usa en una atribución cualificada para especificar el rol de un Agente con respecto a una Entidad. Se recomienda que los valores se administren como un vocabulario controlado de roles de agente, como por ejemplo http://registry.it.csiro.au/def/isotc211/CI_RoleCode. Se usa en una relación cualificada para especificar el rol de una Entidad con respecto a otra Entidad. Se recomienda que los valores se administren como los valores de un vocabulario controlado de roles de entidad como por ejemplo: ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode; IANA Registry of Link Relations https://www.iana.org/assignments/link-relation; el esquema de metadatos de DataCite; MARC relators https://id.loc.gov/vocabulary/relators. Used in a qualified-attribution to specify the role of an Agent with respect to an Entity. It is recommended that the values be managed as a controlled vocabulary of agent roles, such as http://registry.it.csiro.au/def/isotc211/CI_RoleCode. Used in a qualified-relation to specify the role of an Entity with respect to another Entity. It is recommended that the values be managed as a controlled vocabulary of entity roles such as: ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode; IANA Registry of Link Relations https://www.iana.org/assignments/link-relation; DataCite metadata schema; MARC relators https://id.loc.gov/vocabulary/relators. Utilizzato in un'attribuzione qualificata per specificare il ruolo di un agente rispetto a un'entità. Si consiglia di attribuire i valori considerando un vocabolario controllato dei ruoli dell'agente, ad esempio http://registry.it.csiro.au/def/isotc211/CI_RoleCode. Utilizzato in una relazione qualificata per specificare il ruolo di un'entità rispetto a un'altra entità. Si raccomanda che il valore sia preso da un vocabolario controllato di ruoli di entità come ISO 19115 DS_AssociationTypeCode http://registry.it.csiro.au/def/isotc211/DS_AssociationTypeCode, IANA Registry of Link Relations https://www.iana.org/assignments/link-relation, DataCite metadata schema, o MARC relators https://id.loc.gov/vocabulary/relators. Act of carrying out an (Observation) Procedure to estimate or calculate a value of a property of a FeatureOfInterest. Links to a Sensor to describe what made the Observation and how; links to an ObservableProperty to describe what the result is an estimate of, and to a FeatureOfInterest to detail what that property was associated with. Observation Act of carrying out an (Observation) Procedure to estimate or calculate a value of a property of a FeatureOfInterest. Links to a Sensor to describe what made the Observation and how; links to an ObservableProperty to describe what the result is an estimate of, and to a FeatureOfInterest to detail what that property was associated with. The activity of estimating the intensity of an Earthquake using the Mercalli intensity scale is an Observation as is measuring the moment magnitude, i.e., the energy released by said earthquake. A Platform is an entity that hosts other entities, particularly Sensors, Actuators, Samplers, and other Platforms. Platform A Platform is an entity that hosts other entities, particularly Sensors, Actuators, Samplers, and other Platforms. A post, buoy, vehicle, ship, aircraft, satellite, cell-phone, human or animal may act as platforms for (technical or biological) sensors or actuators. Device, agent (including humans), or software (simulation) involved in, or implementing, a Procedure. Sensors respond to a stimulus, e.g., a change in the environment, or input data composed from the results of prior Observations, and generate a Result. Sensors can be hosted by Platforms. Sensor Device, agent (including humans), or software (simulation) involved in, or implementing, a Procedure. Sensors respond to a stimulus, e.g., a change in the environment, or input data composed from the results of prior Observations, and generate a Result. Sensors can be hosted by Platforms. Accelerometers, gyroscopes, barometers, magnetometers, and so forth are Sensors that are typically mounted on a modern smart phone (which acts as Platform). Other examples of sensors include the human eyes. A bus (also omnibus or autobus) is a road vehicle designed to carry passengers. Coaches are luxury busses, usually in service for long distance travel. BusOrCoach A car is a wheeled, self-powered motor vehicle used for transportation. Car A <a class="localLink" href="https://schema.org/CompleteDataFeed">CompleteDataFeed</a> is a <a class="localLink" href="https://schema.org/DataFeed">DataFeed</a> whose standard representation includes content for every item currently in the feed.<br/><br/> This is the equivalent of Atom's element as defined in Feed Paging and Archiving <a href="https://tools.ietf.org/html/rfc5005">RFC 5005</a>, for example (and as defined for Atom), when using data from a feed that represents a collection of items that varies over time (e.g. "Top Twenty Records") there is no need to have newer entries mixed in alongside older, obsolete entries. By marking this feed as a CompleteDataFeed, old entries can be safely discarded when the feed is refreshed, since we can assume the feed has provided descriptions for all current items. CompleteDataFeed A single feed providing structured information about one or more entities or topics. DataFeed A body of structured information describing some topic(s) of interest. Dataset A chemical or biologic substance, used as a medical therapy, that has a physiological effect on an organism. Here the term drug is used interchangeably with the term medicine although clinical knowledge makes a clear difference between them. Drug A subclass of OrganizationRole used to describe employee relationships. EmployeeRole Fitness-related activity designed for a specific health-related purpose, including defined exercise routines as well as activity prescribed by a clinician. ExercisePlan A Role that represents a Web link, e.g. as expressed via the 'url' property. Its linkRelationship property can indicate URL-based and plain textual link types, e.g. those in IANA link registry or others such as 'amphtml'. This structure provides a placeholder where details from HTML's link element can be represented outside of HTML, e.g. in JSON-LD feeds. LinkRole A type of blood vessel that specifically carries lymph fluid unidirectionally toward the heart. LymphaticVessel A guideline recommendation that is regarded as efficacious and where quality of the data supporting the recommendation is sound. MedicalGuidelineRecommendation An observational study is a type of medical study that attempts to infer the possible effect of a treatment through observation of a cohort of subjects over a period of time. In an observational study, the assignment of subjects into treatment groups versus control groups is outside the control of the investigator. This is in contrast with controlled studies, such as the randomized controlled trials represented by MedicalTrial, where each subject is randomly assigned to a treatment group or a control group before the start of the treatment. MedicalObservationalStudy A simple system that adds up the number of risk factors to yield a score that is associated with prognosis, e.g. CHAD score, TIMI risk score. MedicalRiskScore A motorcycle or motorbike is a single-track, two-wheeled motor vehicle. Motorcycle A motorized bicycle is a bicycle with an attached motor used to power the vehicle, or to assist with pedaling. MotorizedBicycle A subclass of Role used to describe roles within organizations. OrganizationRole A medical test performed by a laboratory that typically involves examination of a tissue sample by a pathologist. PathologyTest A PerformanceRole is a Role that some entity places with regard to a theatrical performance, e.g. in a Movie, TVSeries etc. PerformanceRole A photograph. Photograph A doctor's office. Physician A process of care using radiation aimed at improving a health condition. RadiationTherapy A patient-reported or observed dosing schedule for a drug or supplement. ReportedDoseSchedule A Research project. ResearchProject Represents additional information about a relationship or property. For example a Role can be used to say that a 'member' role linking some SportsTeam to a player occurred during a particular time period. Or that a Person's 'actor' role in a Movie was for some particular characterName. Such properties can be attached to a Role entity, which is then associated with the main entities using ordinary properties like 'member' or 'actor'.<br/><br/> See also <a href="http://blog.schema.org/2014/06/introducing-role.html">blog post</a>. Role An indication for treating an underlying condition, symptom, etc. TreatmentIndication A vehicle is a device that is designed or used to transport people or cargo over land, water, air, or through space. Vehicle Vital signs are measures of various physiological functions in order to assess the most basic body functions. VitalSign exploratory term exemplar term example to be eventually removed example to be eventually removed failed exploratory term The term was used in an attempt to structure part of the ontology but in retrospect failed to do a good job Person:Alan Ruttenberg failed exploratory term metadata complete Class has all its metadata, but is either not guaranteed to be in its final location in the asserted IS_A hierarchy or refers to another class that is not complete. metadata complete organizational term Term created to ease viewing/sort terms for development purpose, and will not be included in a release PERSON:Alan Ruttenberg organizational term ready for release Class has undergone final review, is ready for use, and will be included in the next release. Any class lacking "ready_for_release" should be considered likely to change place in hierarchy, have its definition refined, or be obsoleted in the next release. Those classes deemed "ready_for_release" will also derived from a chain of ancestor classes that are also "ready_for_release." ready for release metadata incomplete Class is being worked on; however, the metadata (including definition) are not complete or sufficiently clear to the branch editors. metadata incomplete uncurated Nothing done yet beyond assigning a unique class ID and proposing a preferred term. uncurated pending final vetting All definitions, placement in the asserted IS_A hierarchy and required minimal metadata are complete. The class is awaiting a final review by someone other than the term editor. pending final vetting placeholder removed placeholder removed terms merged An editor note should explain what were the merged terms and the reason for the merge. terms merged term imported This is to be used when the original term has been replaced by a term imported from an other ontology. An editor note should indicate what is the URI of the new term to use. term imported term split This is to be used when a term has been split in two or more new terms. An editor note should indicate the reason for the split and indicate the URIs of the new terms created. term split universal Hard to give a definition for. Intuitively a "natural kind" rather than a collection of any old things, which a class is able to be, formally. At the meta level, universals are defined as positives, are disjoint with their siblings, have single asserted parents. Alan Ruttenberg A Formal Theory of Substances, Qualities, and Universals, http://ontology.buffalo.edu/bfo/SQU.pdf universal defined class A defined class is a class that is defined by a set of logically necessary and sufficient conditions but is not a universal "definitions", in some readings, always are given by necessary and sufficient conditions. So one must be careful (and this is difficult sometimes) to distinguish between defined classes and universal. Alan Ruttenberg defined class named class expression A named class expression is a logical expression that is given a name. The name can be used in place of the expression. named class expressions are used in order to have more concise logical definition but their extensions may not be interesting classes on their own. In languages such as OWL, with no provisions for macros, these show up as actuall classes. Tools may with to not show them as such, and to replace uses of the macros with their expansions Alan Ruttenberg named class expression to be replaced with external ontology term Terms with this status should eventually replaced with a term from another ontology. Alan Ruttenberg group:OBI to be replaced with external ontology term requires discussion A term that is metadata complete, has been reviewed, and problems have been identified that require discussion before release. Such a term requires editor note(s) to identify the outstanding issues. Alan Ruttenberg group:OBI requires discussion Transformation-ML Transformation-ML file describing parameter transformations used in a GvHD experiment. Transformation-ML is a format standard of a digital entity that is conformant with the Transformation-ML standard.(http://wiki.ficcs.org/ficcs/Transformation-ML?action=AttachFile&do=get&target=Transformation-ML_v1.0.26.pdf) person:Jennifer Fostel web-page:http://wiki.ficcs.org/ficcs/Transformation-ML?action=AttachFile&do=get&target=Transformation-ML_v1.0.26.pdf Transformation-ML ACS d06.acs, ACS1.0 data file of well D06 of plate 2 of part 1 of a GvHD experiment. ACS is a format standard of a digital entity that is conformant with the Analytical Cytometry Standard. (http://www.isac-net.org/content/view/607/150/) person:Jennifer Fostel web-page:http://www.isac-net.org/content/view/607/150/ ACS XML RDF/XML file, OWL file, Compensation-ML file, WSDL document, SVG document XML is a format standard of a digital entity that is conformant with the W3C Extensible Markup Language Recommendation.(http://www.w3.org/XML/) person:Jennifer Fostel web-page:http://www.w3.org/XML/ XML RDF A FOAF file, a SKOS file, an OWL file. RDF is a format standard of a digital entity that is conformant with the W3C Resource Description Framework RDF/XML Syntax specification.(http://www.w3.org/RDF/) person:Jennifer Fostel web-page:http://www.w3.org/RDF/ RDF zip MagicDraw MDZIP archive, Java JAR file. zip is a format standard of a digital entity that is conformant with the PKWARE .ZIP file format specification (http://www.pkware.com/index.php?option=com_content&task=view&id=59&Itemid=103/) person:Jennifer Fostel web-page:http://www.pkware.com/index.php?option=com_content&task=view&id=59&Itemid=103/ zip tar Example.tar file. tar is a format standard of a digital entity that is conformant with the tape archive file format as standardized by POSIX.1-1998, POSIX.1-2001, or any other tar format compliant with the GNU tar specification. (http://www.gnu.org/software/tar/manual/) person:Jennifer Fostel web-page:http://www.gnu.org/software/tar/manual/ tar FCS d01.fcs, FCS3 data file of well D06 of plate 2 of part 1 of a GvHD experiment. FCS is a format standard of a digital entity that is conformant with the Flow Cytometry Data File Standard.(http://www.fcspress.com/) person:Jennifer Fostel web-page:http://www.fcspress.com/ FCS Compensation-ML compfoo.xml, Compensation-ML file describing compensation used in a GvHD experiment Compensation-ML is a format standard of a digital entity that is conformant with the Compensation-ML standard. (http://wiki.ficcs.org/ficcs/Compensation-ML?action=AttachFile&do=get&target=Compensation-ML_v1.0.24.pdf) person:Jennifer Fostel web-page:http://wiki.ficcs.org/ficcs/Compensation-ML?action=AttachFile&do=get&target=Compensation-ML_v1.0.24.pdf Compensation-ML Gating-ML foogate.xml, Gating-ML file describing gates used in a GvHD experiment. Gating-ML is a format standard of a digital entity that is conformant with the Gating-ML standard. (http://www.flowcyt.org/gating/) person:Jennifer Fostel web-page:http://www.flowcyt.org/gating/ Gating-ML OWL OBI ontology file, Basic Formal Ontology file, BIRNLex file, BioPAX file. OWL is a format standard of a digital entity that is conformant with the W3C Web Ontology Language specification.(http://www.w3.org/2004/OWL/) person:Jennifer Fostel web-page:http://www.w3.org/2004/OWL/ OWL Affymetrix Affymetrix supplied microarray An organization which supplies technology, tools and protocols for use in high throughput applications Affymetrix Thermo Philippe Rocca-Serra Thermo Waters Philippe Rocca-Serra Waters BIO-RAD Philippe Rocca-Serra BIO-RAD GenePattern hierarchical clustering James Malone GenePattern hierarchical clustering Ambion Philippe Rocca-Serra Ambion Helicos Philippe Rocca-Serra Helicos Roche Philippe Rocca-Serra Roche Illumina Philippe Rocca-Serra Illumina GenePattern PCA GenePattern PCA GenePattern module SVM GenePattern module SVM is a GenePattern software module which is used to run a support vector machine data transformation. James Malone Ryan Brinkman GenePattern module SVM GenePattern k-nearest neighbors James Malone GenePattern k-nearest neighbors GenePattern LOOCV GenePattern LOOCV GenePattern k-means clustering James Malone GenePattern k-means clustering Agilent Philippe Rocca-Serra Agilent GenePattern module KMeansClustering GenePattern module KMeansClustering is a GenePattern software module which is used to perform a k Means clustering data transformation. James Malone PERSON: James Malone GenePattern module KMeansClustering GenePattern CART James Malone GenePattern CART GenePattern module CARTXValidation GenePattern module CARTXValidation is a GenePattern software module which uses a CART decision tree induction with a leave one out cross validation data transformations. GenePattern module CARTXValidation Li-Cor Philippe Rocca-Serra Li-Cor Bruker Corporation Philippe Rocca-Serra Bruker Corporation GenePattern module KNNXValidation GenePattern module KNNXValidation is a GenePattern software module which uses a k-nearest neighbours clustering with a leave one out cross validation data transformations. James Malone PERSON: James Malone GenePattern module KNNXValidation GenePattern module PeakMatch GenePattern module PeakMatch GenePattern module KNN GenePattern module KNN is a GenePattern software module which perform a k-nearest neighbors data transformation. James Malone GenePattern module KNN GenePattern module HierarchicalClustering GenePattern module HierarchicalClustering is a GenePattern software module which is used to perform a hierarchical clustering data transformation. James Malone PERSON: James Malone GenePattern module HierarchicalClustering GenePattern SVM James Malone GenePattern SVM Applied Biosystems Philippe Rocca-Serra Applied Biosystems GenePattern module PCA GenePattern module PCA is a GenePattern software module which is used to perform a principal components analysis dimensionality reduction data transformation. James Malone PERSON: James Malone GenePattern module PCA GenePattern peak matching James Malone Ryan Brinkman GenePattern peak matching Bruker Daltonics Philippe Rocca-Serra Bruker Daltonics GenePattern HeatMapViewer data visualization The GenePattern process of generating Heat Maps from clustered data. James Malone GenePattern HeatMapViewer data visualization GenePattern HierarchicalClusteringViewer data visualization The GenePattern process of generating hierarchical clustering visualization from clustered data. James Malone GenePattern HierarchicalClusteringViewer data visualization GenePattern module HeatMapViewer A GenePattern software module which is used to generate a heatmap view of data. James Malone GenePattern module HeatMapViewer GenePattern module HierarchicalClusteringViewer A GenePattern software module which is used to generate a view of data that has been hierarchically clustered. James Malone GenePattern module HierarchicalClusteringViewer Sysmex Corporation, Kobe, Japan WEB:http://www.sysmex.com/@2009/08/06 Sysmex Corporation, Kobe, Japan U.S. Food and Drug Administration FDA U.S. Food and Drug Administration right handed right handed ambidexterous ambidexterous left handed left handed Edingburgh handedness inventory The Edinburgh Handedness Inventory is a set of questions used to assess the dominance of a person's right or left hand in everyday activities. PERSON:Alan Ruttenberg PERSON:Jessica Turner PMID:5146491#Oldfield, R.C. (1971). The assessment and analysis of handedness: The Edinburgh inventory. Neuropsychologia, 9, 97-113 WEB:http://www.cse.yorku.ca/course_archive/2006-07/W/4441/EdinburghInventory.html Edingburgh handedness inventory eBioscience Karin Breuer WEB:http://www.ebioscience.com/@2011/04/11 eBioscience Cytopeia Karin Breuer WEB:http://www.cytopeia.com/@2011/04/11 Cytopeia Exalpha Biological Karin Breuer WEB:http://www.exalpha.com/@2011/04/11 Exalpha Biological Apogee Flow Systems Karin Breuer WEB:http://www.apogeeflow.com/@2011/04/11 Apogee Flow Systems Exbio Antibodies Karin Breuer WEB:http://www.exbio.cz/@2011/04/11 Exbio Antibodies Becton Dickinson (BD Biosciences) Karin Breuer WEB:http://www.bdbiosciences.com/@2011/04/11 Becton Dickinson (BD Biosciences) Dako Cytomation Karin Breuer WEB:http://www.dakousa.com/@2011/04/11 Dako Cytomation Millipore Karin Breuer WEB:http://www.guavatechnologies.com/@2011/04/11 Millipore Antigenix Karin Breuer WEB:http://www.antigenix.com/@2011/04/11 Antigenix Partec Karin Breuer WEB:http://www.partec.de/@2011/04/11 Partec Beckman Coulter Karin Breuer WEB:http://www.beckmancoulter.com/@2011/04/11 Beckman Coulter Advanced Instruments Inc. (AI Companies) Karin Breuer WEB:http://www.aicompanies.com/@2011/04/11 Advanced Instruments Inc. (AI Companies) Miltenyi Biotec Karin Breuer WEB:http://www.miltenyibiotec.com/@2011/04/11 Miltenyi Biotec AES Chemunex Karin Breuer WEB:http://www.aeschemunex.com/@2011/04/11 AES Chemunex Bentley Instruments Karin Breuer WEB:http://bentleyinstruments.com/@2011/04/11 Bentley Instruments Invitrogen Karin Breuer WEB:http://www.invitrogen.com/@2011/04/11 Invitrogen Luminex Karin Breuer WEB:http://www.luminexcorp.com/@2011/04/11 Luminex CytoBuoy Karin Breuer WEB:http://www.cytobuoy.com/@2011/04/11 CytoBuoy Nimblegen An organization that focuses on manufacturing target enrichment probe pools for DNA sequencing. Person: Jie Zheng Nimblegen Pacific Biosciences An organization that supplies tools for studying the synthesis and regulation of DNA, RNA and protein. It developed a powerful technology platform called single molecule real-time (SMRT) technology which enables real-time analysis of biomolecules with single molecule resolution. Person: Jie Zheng Pacific Biosciences NanoString Technologies An organization that supplies life science tools for translational research and molecular diagnostics based on a novel digital molecular barcoding technology. The NanoString platform can provide simple, multiplexed digital profiling of single molecules. NanoString Technologies An autolysis value specification that indicates no apparent autolytic destruction of an organism cells or tissues. Chris Stoeckert, Helena Ellis NCI BBRB, OBIB NCI BBRB 0-non autolyis An autolysis value specification that indicates slight autolytic destruction of an organism cells or tissues. Chris Stoeckert, Helena Ellis NCI BBRB, OBIB NCI BBRB 1-slight autolysis An autolysis value specification that indicates moderate autolytic destruction of an organism cells or tissues. Chris Stoeckert, Helena Ellis NCI BBRB, OBIB NCI BBRB 2-moderate autolysis An autolysis value specification that indicates severe autolytic destruction of an organism cells or tissues. Chris Stoeckert, Helena Ellis NCI BBRB, OBIB NCI BBRB 3-severe autolysis Thermo Fisher Scientific An organization that is an American multinational, biotechnology product development company, created in 2006 by the merger of Thermo Electron and Fisher Scientific. Chris Stoeckert, Helena Ellis https://en.wikipedia.org/wiki/Thermo_Fisher_Scientific Thermo Fisher Scientific G1: Well differentiated A histologic grade according to AJCC 7th edition indicating that the tumor cells and the organization of the tumor tissue appear close to normal. Chris Stoeckert, Helena Ellis G1 https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet NCI BBRB G1: Well differentiated G2: Moderately differentiated A histologic grade according to AJCC 7th edition indicating that the tumor cells are moderately differentiated and reflect an intermediate grade. Chris Stoeckert, Helena Ellis G2 https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet NCI BBRB G2: Moderately differentiated G3: Poorly differentiated A histologic grade according to AJCC 7th edition indicating that the tumor cells are poorly differentiated and do not look like normal cells and tissue. Chris Stoeckert, Helena Ellis G3 https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet NCI BBRB G3: Poorly differentiated G4: Undifferentiated A histologic grade according to AJCC 7th edition indicating that the tumor cells are undifferentiated and do not look like normal cells and tissue. Chris Stoeckert, Helena Ellis G4 https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet NCI BBRB G4: Undifferentiated G1 (Fuhrman) A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are round, uniform, approximately 10um and that nucleoli are inconspicuous or absent. Chris Stoeckert, Helena Ellis Grade 1 NCI BBRB, OBI NCI BBRB G1 (Fuhrman) G2 (Fuhrman) A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are slightly irregular, approximately 15um and nucleoli are evident. Chris Stoeckert, Helena Ellis Grade 2 NCI BBRB, OBI NCI BBRB G2 (Fuhrman) G3 (Fuhrman) A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are very irregular, approximately 20um and nucleoli large and prominent. Chris Stoeckert, Helena Ellis Grade 3 NCI BBRB, OBI NCI BBRB G3 (Fuhrman) G4 (Fuhrman) A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei arei bizarre and multilobulated, 20um or greater and nucleoli are prominent and chromatin clumped. Chris Stoeckert, Helena Ellis Grade 4 NCI BBRB, OBI NCI BBRB G4 (Fuhrman) Low grade ovarian tumor A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is low grade. Chris Stoeckert, Helena Ellis Low grade NCI BBRB, OBI NCI BBRB Low grade ovarian tumor High grade ovarian tumor A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is high grade. Chris Stoeckert, Helena Ellis High grade NCI BBRB, OBI NCI BBRB High grade ovarian tumor G1 (WHO) A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is well differentiated. Chris Stoeckert, Helena Ellis G1 NCI BBRB, OBI NCI BBRB G1 (WHO) G2 (WHO) A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is moderately differentiated. Chris Stoeckert, Helena Ellis G2 NCI BBRB, OBI NCI BBRB G2 (WHO) G3 (WHO) A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is poorly differentiated. Chris Stoeckert, Helena Ellis G3 NCI BBRB, OBI NCI BBRB G3 (WHO) G4 (WHO) A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is undifferentiated. Chris Stoeckert, Helena Ellis G4 NCI BBRB, OBI NCI BBRB G4 (WHO) pT0 (colon) A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that there is no evidence of primary tumor. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/ NCI BBRB pT0 (colon) pTis (colon) A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating carcinoma in situ (intraepithelial or invasion of lamina propria). Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/ NCI BBRB pTis (colon) pT1 (colon) A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades submucosa. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/ NCI BBRB pT1 (colon) pT2 (colon) A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades muscularis propria. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/ NCI BBRB pT2 (colon) pT3 (colon) A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades subserosa or into non-peritionealized pericolic or perirectal tissues. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/ NCI BBRB pT3 (colon) pT4a (colon) A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor perforates visceral peritoneum. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/ NCI BBRB pT4a (colon) pT4b (colon) A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor directly invades other organs or structures. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/ NCI BBRB pT4b (colon) pT0 (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that there is no evidence of primary tumor. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT0 (lung) pTis (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating carcinoma in situ. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pTis (lung) pT1 (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 3 cm or less in greatest dimension, surrounded by lung or visceral pleura without bronchoscopic evidence of invasion more proximal than the lobar bronchus (i.e., not in the main bronchus). Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT1 (lung) pT1a (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 2 cm or less in greatest dimension. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT1a (lung) pT1b (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 2 cm but not more than 3 cm in greatest dimension. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT1b (lung) pT2 (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 7 cm or the tumor has any of the following features: involves main bronchus, 2 cm or more distal to the carina, invades visceral pleura, associated with atelectasis or obstructive pneumonitis that extends to the hilar region but does not involve the entire lung. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT2 (lung) pT2a (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 5 cm in greatest dimension. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT2a (lung) pT2b (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 5 cm but not more than 7 cm in greatest dimension. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT2b (lung) pT3 (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 7 cm or one that directly invades any of: parietal pleura, chest wall (including superior sulcus tumors), diaphragm, phrenic nerve, mediastinal pleura, parietal pericardiu or the tumor is in the main bronchus less than 2 cm distal to the carina but without involvement of the carina or there is associated atelectasis or obstructive pneumonitis of the entire lung or there is separate tumor nodule(s) in the same lobe as the primary. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT3 (lung) pT4 (lung) A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor of any size that invades any of the following: mediastinum, heart, great vessels, trachea, recurrent laryngeal nerve, esophagus, vertebral body, carina or there is separate tumor nodule(s) in a different ipsilateral lobe to that of the primary. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/ NCI BBRB pT4 (lung) pT0 (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that there is no evidence of primary tumor. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT0 (kidney) pT1 (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 7 cm or less in greatest dimension and limited to the kidney. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT1 (kidney) pT1a (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 4 cm or less. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT1a (kidney) pT1b (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 4 cm but not more than 7 cm. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT1b (kidney) pT2 (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm in greatest dimension and limited to the kidney. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT2 (kidney) pT2a (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm but not more than 10 cm. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT2a (kidney) pT2b (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 10 cm and limited to the kidney. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT2b (kidney) pT3 (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor extends into major veins or perinephric tissues but not into the ipsilateral adrenal gland and not beyond the Gerota fascia. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT3 (kidney) pT3a (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into the renal vein or its segmental (muscle containing) branches, or the tumor invades perirenal and/or renal sinus fat (peripelvic) fat but not beyond Gerota fascia. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT3a (kidney) pT3b (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava below diaphragm. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT3b (kidney) pT3c (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava above the diaphragm or Invades the wall of the vena cava. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT3c (kidney) pT4 (kidney) A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor invades beyond Gerota fascia (including contiguous extension into the ipsilateral adrenal gland). Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/ NCI BBRB pT4 (kidney) pT0 (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that there is no evidence of primary tumor. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT0 (ovary) pT1 (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to the ovaries (one or both). Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT1 (ovary) pT1a (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one ovary; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT1a (ovary) pT1b (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to both ovaries; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT1b (ovary) pT1c (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one or both ovaries with capsule ruptured, tumor on ovarian surface, or malignant cells in ascites or peritoneal washings. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT1c (ovary) pT2 (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with pelvic extension. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT2 (ovary) pT2a (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension and/or implants on uterus and/or tube(s) and no malignant cells in ascites or peritoneal washings. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT2a (ovary) pT2b (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension to other pelvic tissues and no malignant cells in ascites or peritoneal washings. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT2b (ovary) pT2c (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has pelvic extension with malignant cells in ascites or peritoneal washings. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT2c (ovary) pT3 (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with microscopically confirmed peritoneal metastasis outside the pelvis and/or regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT3 (ovary) pT3a (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has microscopic peritoneal metastasis beyond pelvis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT3a (ovary) pT3b (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has macroscopic peritoneal, metastatasis beyond pelvis, 2 cm or less in greatest dimension. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT3b (ovary) pT3c (ovary) A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has peritoneal metastasis beyond pelvis, more than 2 cm in greatest dimension and/or regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/ NCI BBRB pT3c (ovary) pN0 (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating no regional lymph node metastsis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN0 (colon) pN1 (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1-3 regional lymph nodes. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN1 (colon) pN1a (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1 regional lymph node. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN1a (colon) pN1b (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 2-3 regional lymph nodes. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN1b (colon) pN1c (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating tumor deposit(s), i.e., satellites in the subserosa, or in non-peritonealized pericolic or perirectal soft tissue without regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN1c (colon) pN2 (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 or more regional lymph nodes. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN2 (colon) pN2a (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 to 6 regional lymph nodes. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN2a (colon) pN2b (colon) A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 7 or more regional lymph nodes. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/ NCI BBRB pN2b (colon) pN0 (lung) A pathologic lymph node stage for lung according to AJCC 7th edition indicating no regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/ NCI BBRB pN0 (lung) pN1 (lung) A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral peribronchial and/or ipsilateral hilar lymph nodes and intrapulmonary nodes, including involvement by direct extension. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/ NCI BBRB pN1 (lung) pN2 (lung) A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral mediastinal and/or subcarinal lymph node(s). Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/ NCI BBRB pN2 (lung) pN3 (lung) A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in contralateral mediastinal, contralateral hilar, ipsilateral or contralateral scalene, or supraclavicular lymph node(s). Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/ NCI BBRB pN3 (lung) pN0 (kidney) A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is no regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_n/ NCI BBRB pN0 (kidney) pN1 (kidney) A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_n/ NCI BBRB pN1 (kidney) pN0 (ovary) A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is no regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_n/ NCI BBRB pN0 (ovary) pN1 (ovary) A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is regional lymph node metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_n/ NCI BBRB pN1 (ovary) cM0 (colon) A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there are no symptoms or signs of distant metastasis. Chris Stoeckert, Helena Ellis https://en.wikipedia.org/wiki/Cancer_staging#Pathological_M_Categorization_.28cM_and_pM.29 NCI BBRB cM0 (colon) cM1 (colon) A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is clinical evidence of distant metastases by history, physical examination, imaging studies, or invasive procedures, but without microscopic evidence of the presumed distant metastases. Chris Stoeckert, Helena Ellis https://en.wikipedia.org/wiki/Cancer_staging#Pathological_M_Categorization_.28cM_and_pM.29 NCI BBRB cM1 (colon) cM1a (colon) A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ based on clinical assessment. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/ NCI BBRB cM1a (colon) cM1b (colon) A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum based on clinical assessment. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/ NCI BBRB cM1b (colon) pM1 (colon) A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is microscopic evidence confirming distant metastatic disease. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/ NCI BBRB pM1 (colon) pM1a (colon) A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ and histologically confirmed. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/ NCI BBRB pM1a (colon) pM1b (colon) A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum and histologically confirmed. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/ NCI BBRB pM1b (colon) cM0 (lung) A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is no distant metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/ NCI BBRB cM0 (lung) cM1 (lung) A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/ NCI BBRB cM1 (lung) cM1a (lung) A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is based on clinical assessment and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/ NCI BBRB cM1a (lung) cM1b (lung) A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases based on clinical assessment. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/ NCI BBRB cM1b (lung) pM1 (lung) A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/ NCI BBRB pM1 (lung) pM1a (lung) A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is histologically confirmed and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/ NCI BBRB pM1a (lung) pM1b (lung) A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed and associated with distant lymph nodes or carcinomatosis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/ NCI BBRB pM1b (lung) cM0 (kidney) A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is no distant metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/ NCI BBRB cM0 (kidney) cM1 (kidney) A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/ NCI BBRB cM1 (kidney) pM1 (kidney) A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/ NCI BBRB pM1 (kidney) cM0 (ovary) A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is no distant metastasis. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/ NCI BBRB cM0 (ovary) cM1 (ovary) A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis based on clinical assessment. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/ NCI BBRB cM1 (ovary) pM1 (ovary) A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis that is histologically confirmed. Chris Stoeckert, Helena Ellis https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/ NCI BBRB pM1 (ovary) Occult Carcinoma (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating a small carcinoma, either asymptomatic or giving rise to metastases without symptoms due to the primary carcinoma. Chris Stoeckert, Helena Ellis Occult Carcinoma http://www.medilexicon.com/dictionary/14371 NCI BBRB Occult Carcinoma (AJCC 7th) Stage 0 (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating a carcinoma in situ (or melanoma in situ for melanoma of the skin or germ cell neoplasia in situ for testicular germ cell tumors) and generally is considered to have no metastatic potential. Chris Stoeckert, Helena Ellis Stage 0 https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage 0 (AJCC 7th) Stage I (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers that are smaller or less deeply invasive without regional disease or nodes. Chris Stoeckert, Helena Ellis Stage I https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage I (AJCC 7th) Stage IIA (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIB and IIC. Chris Stoeckert, Helena Ellis Stage IIA https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IIA (AJCC 7th) Stage IIB (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIC. Chris Stoeckert, Helena Ellis Stage IIB https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IIB (AJCC 7th) Stage IIC (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIB. Chris Stoeckert, Helena Ellis Stage IIC https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IIC (AJCC 7th) Stage IIIA (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIB and IIIC. Chris Stoeckert, Helena Ellis Stage IIIA https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IIIA (AJCC 7th) Stage IIIB (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIC. Chris Stoeckert, Helena Ellis Stage IIIB https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IIIB (AJCC 7th) Stage IIIC (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIB. Chris Stoeckert, Helena Ellis Stage IIIC https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IIIC (AJCC 7th) Stage IVA (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVB. Chris Stoeckert, Helena Ellis Stage IVA https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IVA (AJCC 7th) Stage IVB (AJCC 7th) A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVA. Chris Stoeckert, Helena Ellis Stage IVB https://en.wikipedia.org/wiki/Cancer_staging NCI BBRB Stage IVB (AJCC 7th) Stage IA (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating invasive carcinoma which can be diagnosed only by microscopy, with deepest invasion <5 mm and the largest extension <7 mm. Chris Stoeckert, Helena Ellis Stage IA https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IA (FIGO) Stage IA1 (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of <3.0 mm in depth and extension of <7.0 mm. Chris Stoeckert, Helena Ellis Stage IA1 https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IA1 (FIGO) Stage IA2 (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of >3.0 mm and not >5.0 mm with an extension of not >7.0 mm. Chris Stoeckert, Helena Ellis Stage IA2 https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IA2 (FIGO) Stage IB (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesions limited to the cervix uteri or pre-clinical cancers greater than stage IA Chris Stoeckert, Helena Ellis Stage IB https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IB (FIGO) Stage IB1 (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA <4.0 cm in greatest dimension. Chris Stoeckert, Helena Ellis Stage IB1 https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IB1 (FIGO) Stage IB2 (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA >4.0 cm in greatest dimension. Chris Stoeckert, Helena Ellis Stage IB2 https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IB2 (FIGO) Stage IIA (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion. Chris Stoeckert, Helena Ellis Stage IIA https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IIA (FIGO) Stage IIA1 (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion <4.0 cm in greatest dimension. Chris Stoeckert, Helena Ellis Stage IIA1 https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IIA1 (FIGO) Stage IIA2 (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion >4.0 cm in greatest dimension. Chris Stoeckert, Helena Ellis Stage IIA2 https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IIA2 (FIGO) Stage IIB (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina with obvious parametrial invasion. Chris Stoeckert, Helena Ellis Stage IIB https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IIB (FIGO) Stage IIIA (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating tumour involves lower third of the vagina, with no extension to the pelvic wall. Chris Stoeckert, Helena Ellis Stage IIIA https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IIIA (FIGO) Stage IIIB (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating extension to the pelvic wall and/or hydronephrosis or non-functioning kidney. Chris Stoeckert, Helena Ellis Stage IIIB https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IIIB (FIGO) Stage IVA (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread of the growth to adjacent organs. Chris Stoeckert, Helena Ellis Stage IVA https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IVA (FIGO) Stage IVB (FIGO) An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread to distant organs. Chris Stoeckert, Helena Ellis Stage IVB https://en.wikipedia.org/wiki/Cervical_cancer_staging NCI BBRB Stage IVB (FIGO) Stage 1 (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1, N0, and M0. Chris Stoeckert, Helena Ellis Stage 1 https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 1 (FIGO) Stage 1A (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1a, N0, and M0. Chris Stoeckert, Helena Ellis Stage 1A https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 1A (FIGO) Stage 1B (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1b, N0, and M0. Chris Stoeckert, Helena Ellis Stage 1B https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 1B (FIGO) Stage 1C (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1c, N0, and M0. Chris Stoeckert, Helena Ellis Stage 1C https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 1C (FIGO) Stage 2 (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2, N0, and M0. Chris Stoeckert, Helena Ellis Stage 2 https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 2 (FIGO) Stage 2A (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2a, N0, and M0. Chris Stoeckert, Helena Ellis Stage 2A https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 2A (FIGO) Stage 2B (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2b, N0, and M0. Chris Stoeckert, Helena Ellis Stage 2B https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 2B (FIGO) Stage 2C (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2c, N0, and M0. Chris Stoeckert, Helena Ellis Stage 2C https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 2C (FIGO) Stage 3 (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3, N0, and M0) or (T3,3a,3b, NX, and M0). Chris Stoeckert, Helena Ellis Stage 3 https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 3 (FIGO) Stage 3A (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3a, N0, and M0 . Chris Stoeckert, Helena Ellis Stage 3A https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 3A (FIGO) Stage 3B (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3b, N0, and M0 . Chris Stoeckert, Helena Ellis Stage 3B https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 3B (FIGO) Stage 3C (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3c, N0,X and M0) or (any T, N1 and M0). Chris Stoeckert, Helena Ellis Stage 3C https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 3C (FIGO) Stage 4 (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of any T, any N, and M1. Chris Stoeckert, Helena Ellis Stage 4 https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage 4 (FIGO) Stage Unknown (FIGO) A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T0, N0, and M0) or (T1,1a-1c,2,2a-2c, NX, and M0) or (TX, N0,X, M0). Chris Stoeckert, Helena Ellis Stage Unknown https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/ NCI BBRB Stage Unknown (FIGO) 3: symptomatic in bed more than 50% of the day but not bed ridden An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and in bed for more than 50% of the day but is not bed ridden. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 3: symptomatic in bed more than 50% of the day but not bed ridden 2: symptomatic but in bed less than 50% of the day An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is in bed for less than 50% of the day. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 2: symptomatic but in bed less than 50% of the day 4: bed ridden An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and is bed ridden. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 4: bed ridden 0: asymptomatic An Eastern Cooperative Oncology Group score value specification indicating a patient is asymptomatic. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 0: asymptomatic 1: symptomatic but fully ambulatory An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is fully ambulatory. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 1: symptomatic but fully ambulatory 100: asymptomatic A Karnofsky score vaue specification indicating that a patient is asymptomatic. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 100: asymptomatic 80-90: symptomatic but fully ambulatory A Karnofsky score vaue specification indicating that a patient is symptomatic but fully ambulatory. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 80-90: symptomatic but fully ambulatory 60-70: symptomatic but in bed less than 50% of the day A Karnofsky score vaue specification indicating that a patient is symptomatic but in bed less than 50% of the day. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 60-70: symptomatic but in bed less than 50% of the day 40-50: symptomatic, in bed more than 50% of the day, but not bed ridden A Karnofsky score vaue specification indicating that a patient is symptomatic, in bed more than 50% of the day, but not bed ridden. Chris Stoeckert, Helena Ellis NCI BBRB, OBI NCI BBRB 40-50: symptomatic, in bed more than 50% of the day, but not bed ridden Oxford Nanopore Technologies An organization that is developing and selling nanopore sequencing products and is based in the UK. James A. Overton https://en.wikipedia.org/wiki/Oxford_Nanopore_Technologies Oxford Nanopore Technologies BioGents An organization that manufactures mosquito traps and other mosquito control products. John Judkins WEB:https://eu.biogents.com/about-biogents/ BioGents The term was added to the ontology on the assumption it was in scope, but it turned out later that it was not. This obsolesence reason should be used conservatively. Typical valid examples are: un-necessary grouping classes in disease ontologies, a phenotype term added on the assumption it was a disease. https://github.com/information-artifact-ontology/ontology-metadata/issues/77 https://orcid.org/0000-0001-5208-3432 out of scope meter A length unit which is equal to the length of the path traveled by light in vacuum during a time interval of 1/299 792 458 of a second. m meter kilogram A mass unit which is equal to the mass of the International Prototype Kilogram kept by the BIPM at Svres, France. kg kilogram second A time unit which is equal to the duration of 9 192 631 770 periods of the radiation corresponding to the transition between the two hyperfine levels of the ground state of the caesium 133 atom. s sec second centimeter A length unit which is equal to one hundredth of a meter or 10^[-2] m. cm centimeter millimeter A length unit which is equal to one thousandth of a meter or 10^[-3] m. mm millimeter micrometer A length unit which is equal to one millionth of a meter or 10^[-6] m. um micrometer nanometer A length unit which is equal to one thousandth of one millionth of a meter or 10^[-9] m. nm nanometer angstrom A length unit which is equal to 10 [-10] m. angstrom gram A mass unit which is equal to one thousandth of a kilogram or 10^[-3] kg. g gram milligram A mass unit which is equal to one thousandth of a gram or 10^[-3] g. mg milligram microgram A mass unit which is equal to one millionth of a gram or 10^[-6] g. ug microgram nanogram A mass unit which is equal to one thousandth of one millionth of a gram or 10^[-9] g. ng nanogram picogram A mass unit which is equal to 10^[-12] g. pg picogram degree Celsius A temperature unit which is equal to one kelvin degree. However, they have their zeros at different points. The centigrade scale has its zero at 273.15 K. C degree C degree Celsius minute A time unit which is equal to 60 seconds. min minute hour A time unit which is equal to 3600 seconds or 60 minutes. h hr hour day A time unit which is equal to 24 hours. day week A time unit which is equal to 7 days. week month A time unit which is approximately equal to the length of time of one of cycle of the moon's phases which in science is taken to be equal to 30 days. month year A time unit which is equal to 12 months which is science is taken to be equal to 365.25 days. year micromole A substance unit equal to a millionth of a mol or 10^[-6] mol. umol micromole nanomole A substance unit equal to one thousandth of one millionth of a mole or 10^[-9] mol. nmol nanomole picomole A substance unit equal to 10^[-12] mol. pmol picomole molar A unit of concentration which expresses a concentration of 1 mole of solute per liter of solution (mol/L). M molar millimolar A unit of molarity which is equal to one thousandth of a molar or 10^[-3] M. mM millimolar micromolar A unit of molarity which is equal to one millionth of a molar or 10^[-6] M. uM micromolar nanomolar A unit of molarity which is equal to one thousandth of one millionth of a molar or 10^[-9] M. nM nanomolar picomolar A unit of molarity which is equal to 10^[-12] M. pM picomolar cubic centimeter A volume unit which is equal to one millionth of a cubic meter or 10^[-9] m^[3], or to 1 ml. cc cubic centimeter milliliter A volume unit which is equal to one thousandth of a liter or 10^[-3] L, or to 1 cubic centimeter. ml milliliter liter A volume unit which is equal to one thousandth of a cubic meter or 10^[-3] m^[3], or to 1 decimeter. L liter cubic decimeter A volume unit which is equal to one thousand of a cubic meter or 10^[-3] m^[3], or to 1 L. cubic decimeter microliter A volume unit which is equal to one millionth of a liter or 10^[-6] L. ul microliter nanoliter A volume unit which is equal to one thousandth of one millionth of a liter or 10^[-9] L. nl nanoliter picoliter A volume unit which is equal to 10^[-12] L. pl picoliter hertz A frequency unit which is equal to 1 complete cycle of a recurring phenomenon in 1 second. hertz mass percentage A dimensionless concentration unit which denotes the mass of a substance in a mixture as a percentage of the mass of the entire mixture. % w/w percent weight pr weight mass percentage mass volume percentage A dimensionless concentration unit which denotes the mass of the substance in a mixture as a percentage of the volume of the entire mixture. % w/v percent vol per vol mass volume percentage volume percentage A dimensionless concentration unit which denotes the volume of the solute in mL per 100 mL of the resulting solution. % v/v percent vol per vol volume percentage gram per liter A mass unit density which is equal to mass of an object in grams divided by the volume in liters. g per L g/L gram per liter milligram per milliliter A mass unit density which is equal to mass of an object in milligrams divided by the volume in milliliters. mg per ml mg/ml milligram per milliliter degree Fahrenheit A temperature unit which is equal to 5/9ths of a kelvin. Negative 40 degrees Fahrenheit is equal to negative 40 degrees Celsius. degree Fahrenheit pH A dimensionless concentration notation which denotes the acidity of a solution in terms of activity of hydrogen ions (H+). pH milliliter per liter A volume per unit volume unit which is equal to one millionth of a liter of solute in one liter of solution. ml per L ml/l milliliter per liter gram per deciliter A mass density unit which is equal to mass of an object in grams divided by the volume in deciliters. g/dl gram per deciliter colony forming unit per volume A concentration unit which a measure of viable bacterial numbers in a given volume. colony forming unit per volume microliters per minute A volumetric flow rate unit which is equal to one microliter volume through a given surface in one minute. microliters per minute count per nanomolar second A rate unit which is equal to one over one nanomolar second. count per nanomolar second count per molar second A rate unit which is equal to one over one molar second. count per molar second count per nanomolar A rate unit which is equal to one over one nanomolar. count per nanomolar count per molar A rate unit which is equal to one over one molar. count per molar microgram per liter A mass unit density which is equal to mass of an object in micrograms divided by the volume in liters. ng/ml ug/L microgram per liter 2000-07-11 A collection is an aggregation of items. The term collection means that the resource is described as a group; its parts may be separately described and navigated. Collection 2000-07-11 A dataset is information encoded in a defined structure (for example, lists, tables, and databases), intended to be useful for direct machine processing. Dataset 2000-07-11 An event is a non-persistent, time-based occurrence. Metadata for an event provides descriptive information that is the basis for discovery of the purpose, location, duration, responsible agents, and links to related events and resources. The resource of type event may not be retrievable if the described instantiation has expired or is yet to occur. Examples - exhibition, web-cast, conference, workshop, open-day, performance, battle, trial, wedding, tea-party, conflagration. Event 2000-07-11 An image is a primarily symbolic visual representation other than text. For example - images and photographs of physical objects, paintings, prints, drawings, other images and graphics, animations and moving pictures, film, diagrams, maps, musical notation. Note that image may include both electronic and physical representations. Image 2000-07-11 An interactive resource is a resource which requires interaction from the user to be understood, executed, or experienced. For example - forms on web pages, applets, multimedia learning objects, chat services, virtual reality. Interactive Resource 2002-07-13 An inanimate, three-dimensional object or substance. For example -- a computer, the great pyramid, a sculpture. Note that digital representations of, or surrogates for, these things should use Image, Text or one of the other types. Physical Object 2000-07-11 Software is a computer program in source or compiled form which may be available for installation non-transiently on another machine. For software which exists only to create an interactive environment, use interactive instead. Software 2000-07-11 A sound is a resource whose content is primarily intended to be rendered as audio. For example - a music playback file format, an audio compact disc, and recorded speech or sounds. Sound 2000-07-11 A text is a resource whose content is primarily words for reading. For example - books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre text. Text 2000-07-11 2002-06-15 The DCMI Box identifies a region of space using its geographic limits. DCMI Box 2000-07-11 2002-06-15 Dewey Decimal Classification DDC 2000-07-11 2002-06-15 The Internet media type of the resource. IMT 2000-07-11 2002-06-15 ISO 3166 Codes for the representation of names of countries ISO 3166 2000-07-11 2002-06-15 ISO 639-2: Codes for the representation of names of languages. ISO 639-2 2000-07-11 2002-06-15 Library of Congress Classification LCC 2000-07-11 2002-06-15 Library of Congress Subject Headings LCSH 2000-07-11 2002-06-15 Medical Subject Headings MeSH 2000-07-11 2002-06-15 A specification of the limits of a time interval. DCMI Period 2000-07-11 2002-06-15 The DCMI Point identifies a point in space using its geographic coordinates. DCMI Point 2000-07-11 2002-06-15 Internet RFC 1766 'Tags for the identification of Language' specifies a two letter code taken from ISO 639, followed optionally by a two letter country code taken from ISO 3166. RFC 1766 2002-07-13 Internet RFC 3066 'Tags for the Identification of Languages' specifies a primary subtag which is a two-letter code taken from ISO 639 part 1 or a three-letter code taken from ISO 639 part 2, followed optionally by a two-letter country code taken from ISO 3166. When a language in ISO 639 has both a two-letter and three-letter code, use the two-letter code; when it has only a three-letter code, use the three-letter code. This RFC replaces RFC 1766. RFC 3066 2000-07-11 2002-06-15 The Getty Thesaurus of Geographic Names TGN 2000-07-11 2002-06-15 Universal Decimal Classification UDC 2000-07-11 2002-06-15 A URI Uniform Resource Identifier URI 2000-07-11 2002-06-15 W3C Encoding rules for dates and times - a profile based on ISO 8601 W3C-DTF Science Data Discovery Ontology None https://creativecommons.org/licenses/unspecified .sam Sequence Alignment/Map format Wiggle format .maf A specification of the genetic state of an organism, whether complete (defined over the whole genome) or incomplete (defined over a subset of the genome). Genotypes typically describe this genetic state as a diff between some variant component and a canonical reference. As information artifacts, genotypes specify the state of a genome be defining a diff between some canonical reference and a variant or alternate sequence that replaces the corresponding portion of the reference. We can consider a genotype then as a collection of these reference and variant features, along with some rule for operating on them and resolve a final single sequence. This is valid ontologically because we commit only to sequence features being GDCs - which allows for their concretization in either biological or informational patterns. Accordingly, a particular gene allele, such as shh<tbx292>, can be part of a genome in a biological sense and part of a genotype in an informational sense. This idea underpins the 'genotype partonomy' at the core of the GENO model that decomposes a complete genotype into its more fundamental parts, including alleles and allele complements, as described in the comment above. Core definition above adapted from the GA4GH VMC data model definition here: https://docs.google.com/document/d/12E8WbQlvfZWk5NrxwLytmympPby6vsv60RxCeD5wc1E/edit#heading=h.4e32jj4jtmsl (retrieved 2018-04-09). Note however that the VMC genotype concept likely is not intended to cover 'effective' and 'extrinsic' genotype concepts defined in GENO. 1. Scope of 'Genetic State': 'Genetic state' is considered quite broadly in GENO to describe two general kinds of 'states'. First, is traditional notion of 'allelic state' - defined as the complement of alleles present at a particular location or locations in a genome (i.e. across all homologous chromosomes containing this location). Here, a genotype can describe allelic state at a specific locus in a genome (an 'allelic genotype'), or describe the allelic state across the entire genome ('genomic genotype'). Second, this concept can also describe states of genomic features 'extrinsic' to their intrinsic sequence, such as the expression status of a gene as a result of being specifically targeted by experimental interventions such as RNAi, morpholinos, or CRISPRs. 2. Genotype Subtypes: In GENO, we use the term 'intrinsic' for genotypes describing variation in genomic sequence, and 'extrinsic' for genotypes describing variation in gene expression (e.g. resulting from the targeted experimental knock-down or over-expression of endogenous genes). We use the term 'effective genotype' to describe the total intrinsic and extrinsic variation in a cell or organism at the time a phenotypic assessment is performed. Two more precise conccepts are subsumed by the notion of an 'intrinsic genotype': (1) 'allelic genotypes', which specify allelic state at a single genomic location; and (2) 'genomic genotypes', which specify allelic state across an entire genome. In both cases, allelic state is typically specified in terms of a differential between a reference and a set of 1 or more known variant features. 3. The Genotype Partonomy: 'Genomic genotypes' describing sequence variation across an entire genome are 'decomposed' in GENO into a partonomy of more granular levels of variation. These levels are defined to be meaningful to biologists in their attempts to relate genetic variation to phenotypic features. They include 'genomic variation complement' (GVC), 'variant single locus complement' (VSLC), 'allele', 'haplotype', 'sequence alteration', and 'genomic background' classes. For example, the components of the zebrafish genotype "fgf8a<ti282a/ti282a>; fgf3<t24149/+>[AB]", described at zfin.org/ZDB-FISH-150901-9362, include the following elements: - GVC: fgf8a<ti282a/ti282a>; fgf3<t24149/+> (total intrinsic variation in the genome) - Genomic Background: AB (the reference against which the GVC is variant) - VSLC1: fgf8a<ti282a/ti282a> (homozygous complement of gene alleles at one known variant locus) - VSLC2: fgf3<t24149/+> (heterozygous complement of gene alleles at another known variant locus) - Allele 1: fgf8a<ti282a> (variant version of the fgf8a gene, present in two copies) - Allele 2: fgf3<t24149> (variant version of the fgf3 gene, present in one copy) - Allele 3: fgf3<+> (wild-type version of the fgf3 gene, present in one copy) - Sequence Alteration1: <ti282a> (the specific mutation within the fgf8a gene that makes it variant) - Sequence Alteration2: <t24149> (the specific mutation within the fgf3 gene that makes it variant) A graphical representation of this decomposition that maps each element to a visual depiction of the portion of a genome it denotes can be found here: https://github.com/monarch-initiative/GENO-ontology/blob/develop/README.md One reason that explicit representation of these levels is important is because it is at these levels that phenotypic features are annotated to genetic variations in different clinical and model organism databases For example, ZFIN typically annotates phenotypes to effective genotypes, MGI to intrinsic genotypes, Wormbase to variant alleles, and ClinVar to haplotypes and sequence alterations. The ability to decompose a genotype into representations at these levels allows us to "propagate phenotypes" up or down the partonomy (e.g. infer associations of phenotypes annotated to a genotype to its more granular levels of variation and the gene(s) affected). This helps to supporting integrated analysis of G2P data. genotype has_genotype 2000-07-11 A service is a system that provides one or more functions of value to the end-user. Examples include: a photocopying service, a banking service, an authentication service, interlibrary loans, a Z39.50 or Web server. Service true MF(X)-directly_regulates->MF(Y)-enabled_by->GP(Z) => MF(Y)-has_input->GP(Y) e.g. if 'protein kinase activity'(X) directly_regulates 'protein binding activity (Y)and this is enabled by GP(Z) then X has_input Z infer input from direct reg GP(X)-enables->MF(Y)-has_part->MF(Z) => GP(X) enables MF(Z), e.g. if GP X enables ATPase coupled transporter activity' and 'ATPase coupled transporter activity' has_part 'ATPase activity' then GP(X) enables 'ATPase activity' enabling an MF enables its parts GP(X)-enables->MF(Y)-has_part->MF(Z) => GP(X) enables MF(Z), e.g. if GP X enables ATPase coupled transporter activity' and 'ATPase coupled transporter activity' has_part 'ATPase activity' then GP(X) enables 'ATPase activity' enabling an MF enables its parts true GP(X)-enables->MF(Y)-part_of->BP(Z) => GP(X) involved_in BP(Z) e.g. if X enables 'protein kinase activity' and Y 'part of' 'signal tranduction' then X involved in 'signal transduction' involved in BP true GP(X)-enables->MF(Y)-part_of->BP(Z) => GP(X) involved_in BP(Z) e.g. if X enables 'protein kinase activity' and Y 'part of' 'signal tranduction' then X involved in 'signal transduction' involved in BP If a molecular function (X) has a regulatory subfunction, then any gene product which is an input to that subfunction has an activity that directly_regulates X. Note: this is intended for cases where the regaultory subfunction is protein binding, so it could be tightened with an additional clause to specify this. inferring direct reg edge from input to regulatory subfunction If a molecular function (X) has a regulatory subfunction, then any gene product which is an input to that subfunction has an activity that directly_regulates X. Note: this is intended for cases where the regaultory subfunction is protein binding, so it could be tightened with an additional clause to specify this. inferring direct reg edge from input to regulatory subfunction inferring direct neg reg edge from input to regulatory subfunction inferring direct neg reg edge from input to regulatory subfunction inferring direct positive reg edge from input to regulatory subfunction inferring direct positive reg edge from input to regulatory subfunction effector input is compound function input Input of effector is input of its parent MF if effector directly regulates X, its parent MF directly regulates X if effector directly positively regulates X, its parent MF directly positively regulates X if effector directly negatively regulates X, its parent MF directly negatively regulates X effector input is compound function input Input of effector is input of its parent MF if effector directly regulates X, its parent MF directly regulates X if effector directly positively regulates X, its parent MF directly positively regulates X if effector directly negatively regulates X, its parent MF directly negatively regulates X 'causally downstream of' and 'overlaps' should be disjoint properties (a SWRL rule is required because these are non-simple properties). 'causally upstream of' and 'overlaps' should be disjoint properties (a SWRL rule is required because these are non-simple properties). 'causally downstream of' and 'overlaps' should be disjoint properties (a SWRL rule is required because these are non-simple properties). 'causally upstream of' and 'overlaps' should be disjoint properties (a SWRL rule is required because these are non-simple properties).